AlignACE version 2.2  July 7, 1998
/home/amcguire/bin/alignACE -i136_Transmembrane_Transport_10_mpneu_reg_300.orf -o136_mpneu_300.ace -a/home/amcguire/alignace/lib/ORF_mpneu.txt -z/skink1/amcguire/genomes/mpneu.fna -g0.40 -x5 -e 
Parameter values:
 expect =  	5
 ncols =   	10
 npass =   	1000
 maxnpass =	100
 nruns =   	1000
 maxnruns =	100
 repeat =  	15
 maxreps = 	3
 nread =   	500
 ncycles = 	1
 fragment =	1
 psfact =  	0.1
 gcback =  	0.4
 maxlen =  	30
 weight =  	0.8
 exclude = 	1

Input sequences:
#1	RMP00137	300	Mycoplasma_pneumoniae

Motif number 1

gaaattaccacctctacttcccagagtttggg	1	54	1	cctctatccc	    0.996846	-247
aaacgtgagtcctccaactcccaaactctggg	1	73	0	cctccatccc	    0.998932	-228
gtggttattacccctacatcgagttgactatc	1	114	0	cccctatcga	      0.9533	-187
gtaataaccaccttcatttacctgaacttggt	1	135	1	ccttcatacc	    0.990724	-166
gactattcccactccagctaccaagttcaggt	1	154	0	actccatacc	    0.979961	-147
ctaaaacggaccttcatatcgagtcaaccaat	1	196	0	ccttcatcga	    0.982391	-105
          ******  ****

Masking position 6
Map Score:   7.24678

Number of sites scoring better than the average of aligned sites = 38
Number in coding regions = 35
Number in noncoding regions = 3
Number of orfs with sites within 600 bp upstream = 3
Fraction of orfs with sites within 600 bp upstream = 0.00048185


Motif number 2

gagttgactatctcgtggactaaacgtgag	1	96	0	tctcgtggac	    0.994149	-205
tacccctacatcgagttgactatctcgtgg	1	108	0	tcgagttgac	    0.993789	-193
gaccttcatatcgagtcaaccaatctcgtg	1	190	0	tcgagtcaac	    0.983523	-111
tattaatacttcgcttggacatgcttctaa	1	224	0	tcgcttggac	    0.994149	-77
          **********

Masking position 6
Map Score:   3.7103

Number of sites scoring better than the average of aligned sites = 9
Number in coding regions = 7
Number in noncoding regions = 2
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 3

atattctaattcaatccgcaaa          	1	1	0	tcaatccaaa	    0.993064	-300
aatatactgatcaatctgcaaacctagaaatt	1	28	1	tcaatccaaa	    0.993064	-273
acgtgagtcctccaactcccaaactctgggaa	1	71	0	tccaacccaa	    0.982395	-230
ctattcccactccagctaccaagttcaggtaa	1	152	0	tccagcccaa	    0.988053	-149
taaatcggtttcgatcaaaaattcgccagaat	1	258	1	tcgatcaaat	    0.894207	-43
aatattaatttcgttcatcaaaaa        	1	287	1	tcgttccaaa	    0.982024	-14
          ******  ****

Masking position 11
Map Score:   4.67857

Number of sites scoring better than the average of aligned sites = 59
Number in coding regions = 54
Number in noncoding regions = 5
Number of orfs with sites within 600 bp upstream = 2
Fraction of orfs with sites within 600 bp upstream = 0.000321234


Motif number 4

gggaagtagaggtggtaatttctaggtttg	1	46	0	ggtggtaatt	    0.976259	-255
aactcgatgtaggggtaataaccaccttca	1	121	1	aggggtaata	    0.990468	-180
tggtagctggagtgggaatagtccccacac	1	163	1	agtgggaata	    0.990467	-138
gtccaagcgaagtattaatataattaaatc	1	234	1	agtattaata	     0.91818	-67
          **********

Masking position 7
Map Score:   1.0189

Number of sites scoring better than the average of aligned sites = 71
Number in coding regions = 66
Number in noncoding regions = 5
Number of orfs with sites within 600 bp upstream = 4
Fraction of orfs with sites within 600 bp upstream = 0.000642467


Motif number 5

atattctaattcaatccgcaaa        	1	3	0	tcaatccgca	    0.996794	-298
aatatactgatcaatctgcaaacctagaaa	1	28	1	tcaatctgca	    0.995083	-273
          **********

Masking position 5
Map Score:   0.50812

Number of sites scoring better than the average of aligned sites = 4
Number in coding regions = 4
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 6

          **********

No masking
Map Score:   7.91135e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 7

          **********

No masking
Map Score:   7.91135e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 8

          **********

No masking
Map Score:   7.91135e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0