AlignACE version 2.2  July 7, 1998
/home/amcguire/bin/alignACE -i150_ATP_synthase_1_mpneu_reg_300.orf -o150_mpneu_300.ace -a/home/amcguire/alignace/lib/ORF_mpneu.txt -z/skink1/amcguire/genomes/mpneu.fna -g0.40 -x5 -e 
Parameter values:
 expect =  	5
 ncols =   	10
 npass =   	1000
 maxnpass =	100
 nruns =   	1000
 maxnruns =	100
 repeat =  	15
 maxreps = 	3
 nread =   	500
 ncycles = 	1
 fragment =	1
 psfact =  	0.1
 gcback =  	0.4
 maxlen =  	30
 weight =  	0.8
 exclude = 	1

Input sequences:
#1	RMP00239	300	Mycoplasma_pneumoniae

Motif number 1

aagtcccctagttttaataaaccaaccacg	1	33	0	gttttaataa	    0.888054	-268
ctaggggacttttttgaaaagtttaagcat	1	52	1	tttttgaaaa	    0.818012	-249
gtaactcgttgttttgataaatgcttaaac	1	72	0	gttttgataa	     0.97006	-229
tggttccttttttgtggcacggtatttgct	1	111	1	tttgtggcac	    0.932692	-190
attgctcgccttttttataagaccgcaata	1	156	1	ttttttataa	    0.900132	-145
cgttgaaattattgtggcaatcacatgaaa	1	187	0	attgtggcaa	    0.940696	-114
gatatcactatttttagcaatgggaaaaat	1	219	0	tttttagcaa	      0.9623	-82
tggaaatcaggtttttgcaatgatattcca	1	266	0	gtttttgcaa	    0.974031	-35
          **********

Masking position 9
Map Score:   6.94547

Number of sites scoring better than the average of aligned sites = 438
Number in coding regions = 360
Number in noncoding regions = 78
Number of orfs with sites within 600 bp upstream = 61
Fraction of orfs with sites within 600 bp upstream = 0.00979762


Motif number 2

gttggtttattaaaactaggggacttttttg	1	37	1	taaaataggg	    0.985247	-264
ggcaatcacatgaaaatattgcggtcttata	1	171	0	tgaaatattg	    0.991185	-130
aaaataacgttgaaattattgtggcaatcac	1	193	0	tgaaatattg	    0.991185	-108
ttcccattgctaaaaatagtgatatcatttg	1	223	1	taaaatagtg	    0.991211	-78
          ***** *****

Masking position 5
Map Score:   3.93341

Number of sites scoring better than the average of aligned sites = 31
Number in coding regions = 27
Number in noncoding regions = 4
Number of orfs with sites within 600 bp upstream = 2
Fraction of orfs with sites within 600 bp upstream = 0.000321234


Motif number 3

aaactaggggacttttttgaaaagtttaag	1	49	1	acttttttga	    0.846563	-252
caacgagttacggttttctttggttccttt	1	91	1	cggttttctt	    0.916485	-210
ttctttggttccttttttgtggcacggtat	1	106	1	ccttttttgt	    0.985194	-195
ttttgtggcacggtatttgctgtacctgat	1	120	1	cggtatttgc	    0.974402	-181
gtattgctcgccttttttataagaccgcaa	1	154	1	ccttttttat	    0.927278	-147
ataatttcaacgttatttttcccattgcta	1	205	1	cgttattttt	    0.927786	-96
cttggaaatcaggtttttgcaatgatattc	1	268	0	aggtttttgc	    0.959791	-33
          **********

Masking position 6
Map Score:   3.70348

Number of sites scoring better than the average of aligned sites = 409
Number in coding regions = 368
Number in noncoding regions = 41
Number of orfs with sites within 600 bp upstream = 39
Fraction of orfs with sites within 600 bp upstream = 0.00626405


Motif number 4

cgagcaatacgggaatcaggtacagcaaat	1	134	0	gggaatcagg	     0.99743	-167
aaattattgtggcaatcacatgaaaatatt	1	182	0	ggcaatcaca	    0.987167	-119
tattgagcttggaaatcaggtttttgcaat	1	275	0	ggaaatcagg	    0.996198	-26
          **********

Masking position 5
Map Score:   1.768

Number of sites scoring better than the average of aligned sites = 6
Number in coding regions = 5
Number in noncoding regions = 1
Number of orfs with sites within 600 bp upstream = 1
Fraction of orfs with sites within 600 bp upstream = 0.000160617


Motif number 5

          **********

No masking
Map Score:   7.91135e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 6

          **********

No masking
Map Score:   7.91135e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 7

          **********

No masking
Map Score:   7.91135e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0