AlignACE version 2.2  July 7, 1998
/home/amcguire/bin/alignACE -i179_folate_biosynthesis_mpneu_reg_100.orf -o179_mpneu_100.ace -a/home/amcguire/alignace/lib/ORF_mpneu.txt -z/skink1/amcguire/genomes/mpneu.fna -g0.40 -x5 -e 
Parameter values:
 expect =  	5
 ncols =   	10
 npass =   	1000
 maxnpass =	100
 nruns =   	1000
 maxnruns =	100
 repeat =  	15
 maxreps = 	3
 nread =   	500
 ncycles = 	1
 fragment =	1
 psfact =  	0.1
 gcback =  	0.4
 maxlen =  	30
 weight =  	0.8
 exclude = 	1

Input sequences:
#1	RMP00361	287	Mycoplasma_pneumoniae

Motif number 1

aattacgctattctgattttataagattct	1	12	1	ttctgatttt	    0.986633	-276
gttatcacgaatctgttttttaaagatttt	1	153	0	atctgttttt	    0.986633	-135
catcgccttaatttggttttcggtgattgg	1	186	0	atttggtttt	    0.980647	-102
tattaattacttctggtttttaatggagcg	1	267	0	ttctggtttt	    0.995057	-21
          **********

Masking position 4
Map Score:   5.29988

Number of sites scoring better than the average of aligned sites = 25
Number in coding regions = 22
Number in noncoding regions = 3
Number of orfs with sites within 600 bp upstream = 3
Fraction of orfs with sites within 600 bp upstream = 0.00048185


Motif number 2

gctattctgattttataagattctagagag	1	18	1	ttttataaga	    0.892864	-270
tttttaaagattttgatagaaataaaatag	1	137	0	ttttgataga	    0.981698	-151
acgaatctgttttttaaagattttgataga	1	147	0	tttttaaaga	    0.877965	-141
tacttctggtttttaatggagcgcataatt	1	260	0	ttttaatgga	    0.974887	-28
          **********

Masking position 4
Map Score:   1.7086

Number of sites scoring better than the average of aligned sites = 101
Number in coding regions = 68
Number in noncoding regions = 33
Number of orfs with sites within 600 bp upstream = 24
Fraction of orfs with sites within 600 bp upstream = 0.0038548


Motif number 3

tcatatctatatcttaatcttaatcctctct	1	42	0	atcttatctt	    0.939725	-246
gatatgaatgatcttgcgcttgccttaggtt	1	66	1	atcttggctt	    0.974523	-222
tcttgcgcttgccttaggtttgggaattccc	1	77	1	gccttagttt	    0.989445	-211
ggcatacatcgccttaatttggttttcggtg	1	191	0	gccttatttg	    0.920523	-97
gccaaaatgggtcgtaagctttctgaaacac	1	219	1	gtcgtagctt	    0.980365	-69
taatttccttgacttgtgtttcagaaagctt	1	234	0	gacttggttt	    0.966093	-54
          ****** ****

Masking position 5
Map Score:   2.02356

Number of sites scoring better than the average of aligned sites = 136
Number in coding regions = 119
Number in noncoding regions = 17
Number of orfs with sites within 600 bp upstream = 12
Fraction of orfs with sites within 600 bp upstream = 0.0019274


Motif number 4

          **********

No masking
Map Score:   2.93755e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 5

          **********

No masking
Map Score:   2.93755e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 6

          **********

No masking
Map Score:   2.93755e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0