AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i190_ribonucleoside_diphos___mpneu_reg_100.orf -o190_mpneu_100.ace -a/home/amcguire/alignace/lib/ORF_mpneu.txt -z/skink1/amcguire/genomes/mpneu.fna -g0.40 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.4 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMP00513 23 Mycoplasma_pneumoniae #2 RMP00517 300 Mycoplasma_pneumoniae Motif number 1 tttttcgtaagtcgcaaatagagaattggt 2 31 1 gtcgcaaata 0.954833 -270 tctgtgatttttcggcaaaatcgtcgagtt 2 78 0 ttcggcaaaa 0.996516 -223 ttccgaaagattcgcgaatattctgtgatt 2 99 0 ttcgcgaata 0.972865 -202 tcgcgaatctttcggaaaagacacggtaaa 2 112 1 ttcggaaaag 0.980359 -189 actcgggatgtccggcaaaacccccgaatg 2 161 1 tccggcaaaa 0.987521 -140 cccccgaatgttcgccaataattgtaacaa 2 181 1 ttcgccaata 0.992139 -120 actcgattacctcggaaaattttgttacaa 2 224 0 ctcggaaaat 0.899454 -77 tattcgaaatttcgccaaaattgtgacgtt 2 257 0 ttcgccaaaa 0.995822 -44 aatttgcggaaaaaaatttcgaaa 2 287 0 tgcggaaaaa 0.98036 -14 ********** Masking position 7 Map Score: 18.4589 Number of sites scoring better than the average of aligned sites = 65 Number in coding regions = 62 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 2 acggtattctgttttttatgtttttcg 2 6 1 attctgtttt 0.983095 -295 ttatcaattaactcgacgattttgccgaaaaa 2 69 1 actcgaattt 0.962701 -232 attcgcgaatattctgtgatttttcggcaaaa 2 88 0 attctgattt 0.973154 -213 cgatccttttaccgtgtcttttccgaaagatt 2 117 0 accgtgtttt 0.793009 -184 aaaggatcgaactcggattttactcgggatgt 2 140 1 actcggttta 0.938632 -161 attggcgaacattcgggggttttgccggacat 2 168 0 attcgggttt 0.989212 -133 tgttacaattattggacaattttgttacaatt 2 200 0 attggaattt 0.941463 -101 tttcgccaaaattgtgacgtttttactcgatt 2 246 0 attgtggttt 0.945539 -55 atttcgaaatattcgaaatttcgccaaaattg 2 264 0 attcgatttc 0.931447 -37 atttcgaatatttcgaaatttttttccgcaaa 2 277 1 tttcgatttt 0.8911 -24 ****** **** Masking position 10 Map Score: 9.72485 Number of sites scoring better than the average of aligned sites = 164 Number in coding regions = 142 Number in noncoding regions = 22 Number of orfs with sites within 600 bp upstream = 18 Fraction of orfs with sites within 600 bp upstream = 0.0028911 Motif number 3 gcaaaatcgtcgagttaattgataagtttgg 2 63 0 cgagtaattg 0.916948 -238 tgtgatttttcggcaaaatcgtcgagttaat 2 75 0 cggcaaatcg 0.931193 -226 cgaaaaatcacagaatattcgcgaatctttc 2 94 1 cagatattcg 0.927057 -207 gtgtcttttccgaaagattcgcgaatattct 2 105 0 cgaagattcg 0.761961 -196 ggattttactcgggatgtccggcaaaacccc 2 154 1 cgggtgtccg 0.941653 -147 ggcaaaacccccgaatgttcgccaataattg 2 174 1 ccgatgttcg 0.955397 -127 caaaattttccgaggtaatcgagtaaaaacg 2 230 1 cgagtaatcg 0.98512 -71 aaaaaaatttcgaaatattcgaaatttcgcc 2 271 0 cgaatattcg 0.609924 -30 **** ****** Masking position 1 Map Score: 8.93703 Number of sites scoring better than the average of aligned sites = 78 Number in coding regions = 67 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 4 tggacaattttgttacaattattggcgaac 2 190 0 tgttacaatt 0.993794 -111 cggaaaattttgttacaattattggacaat 2 212 0 tgttacaatt 0.993794 -89 cgagtaaaaacgtcacaattttggcgaaat 2 249 1 cgtcacaatt 0.99132 -52 ********** Masking position 5 Map Score: 3.45596 Number of sites scoring better than the average of aligned sites = 3 Number in coding regions = 1 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 5 ggcaataattactaatcggt 1 1 1 ggcaataatt 0.906986 -23 gataagtttggccaccaattctctatttgc 2 44 0 gccaccaatt 0.96387 -257 atcaattaactcgacgattttgccgaaaaa 2 71 1 tcgacgattt 0.901373 -230 cagaatattcgcgaatctttcggaaaagac 2 104 1 gcgaatcttt 0.970898 -197 aaatccgagttcgatccttttaccgtgtct 2 130 0 tcgatccttt 0.777371 -171 ccgaatgttcgccaataattgtaacaaaat 2 184 1 gccaataatt 0.98331 -117 aacaaaattgtccaataattgtaacaaaat 2 206 1 tccaataatt 0.973784 -95 tggcgaaatttcgaatatttcgaaattttt 2 270 1 tcgaatattt 0.973784 -31 ********** Masking position 4 Map Score: 7.54976 Number of sites scoring better than the average of aligned sites = 86 Number in coding regions = 73 Number in noncoding regions = 13 Number of orfs with sites within 600 bp upstream = 12 Fraction of orfs with sites within 600 bp upstream = 0.0019274 Motif number 6 ********** No masking Map Score: -4.38104e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -4.38104e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -4.38104e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0