AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i190_ribonucleoside_diphos___mpneu_reg_300.orf -o190_mpneu_300.ace -a/home/amcguire/alignace/lib/ORF_mpneu.txt -z/skink1/amcguire/genomes/mpneu.fna -g0.40 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.4 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMP00513 23 Mycoplasma_pneumoniae #2 RMP00517 300 Mycoplasma_pneumoniae Motif number 1 tttttcgtaagtcgcaaatagagaattggt 2 31 1 gtcgcaaata 0.957095 -270 tctgtgatttttcggcaaaatcgtcgagtt 2 78 0 ttcggcaaaa 0.996682 -223 ttccgaaagattcgcgaatattctgtgatt 2 99 0 ttcgcgaata 0.974248 -202 tcgcgaatctttcggaaaagacacggtaaa 2 112 1 ttcggaaaag 0.981368 -189 actcgggatgtccggcaaaacccccgaatg 2 161 1 tccggcaaaa 0.988165 -140 cccccgaatgttcgccaataattgtaacaa 2 181 1 ttcgccaata 0.992547 -120 actcgattacctcggaaaattttgttacaa 2 224 0 ctcggaaaat 0.90421 -77 tattcgaaatttcgccaaaattgtgacgtt 2 257 0 ttcgccaaaa 0.996036 -44 aatttgcggaaaaaaatttcgaaa 2 287 0 tgcggaaaaa 0.981369 -14 ********** Masking position 7 Map Score: 18.4589 Number of sites scoring better than the average of aligned sites = 65 Number in coding regions = 62 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 2 acggtattctgttttttatgtttttcg 2 6 1 attctgtttt 0.983208 -295 ttatcaattaactcgacgattttgccgaaaaa 2 69 1 actcgaattt 0.962945 -232 attcgcgaatattctgtgatttttcggcaaaa 2 88 0 attctgattt 0.973332 -213 cgatccttttaccgtgtcttttccgaaagatt 2 117 0 accgtgtttt 0.794125 -184 aaaggatcgaactcggattttactcgggatgt 2 140 1 actcggttta 0.939023 -161 attggcgaacattcgggggttttgccggacat 2 168 0 attcgggttt 0.989285 -133 tgttacaattattggacaattttgttacaatt 2 200 0 attggaattt 0.941837 -101 tttcgccaaaattgtgacgtttttactcgatt 2 246 0 attgtggttt 0.945889 -55 atttcgaaatattcgaaatttcgccaaaattg 2 264 0 attcgatttc 0.931881 -37 atttcgaatatttcgaaatttttttccgcaaa 2 277 1 tttcgatttt 0.891759 -24 ****** **** Masking position 10 Map Score: 9.72485 Number of sites scoring better than the average of aligned sites = 164 Number in coding regions = 142 Number in noncoding regions = 22 Number of orfs with sites within 600 bp upstream = 18 Fraction of orfs with sites within 600 bp upstream = 0.0028911 Motif number 3 ccaaacttatcaattaactcgacgattttgc 2 63 1 caattactcg 0.916948 -238 attaactcgacgattttgccgaaaaatcaca 2 75 1 cgatttgccg 0.931193 -226 gaaagattcgcgaatattctgtgatttttcg 2 94 0 cgaatatctg 0.927057 -207 agaatattcgcgaatctttcggaaaagacac 2 105 1 cgaatcttcg 0.761961 -196 ggggttttgccggacatcccgagtaaaatcc 2 154 0 cggacacccg 0.941653 -147 caattattggcgaacattcgggggttttgcc 2 174 0 cgaacatcgg 0.955397 -127 cgtttttactcgattacctcggaaaattttg 2 230 0 cgattactcg 0.98512 -71 ggcgaaatttcgaatatttcgaaattttttt 2 271 1 cgaatattcg 0.609924 -30 ****** **** Masking position 1 Map Score: 8.93703 Number of sites scoring better than the average of aligned sites = 78 Number in coding regions = 67 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 4 tggacaattttgttacaattattggcgaac 2 190 0 tgttacaatt 0.993754 -111 cggaaaattttgttacaattattggacaat 2 212 0 tgttacaatt 0.993754 -89 cgagtaaaaacgtcacaattttggcgaaat 2 249 1 cgtcacaatt 0.991263 -52 ********** Masking position 5 Map Score: 3.45596 Number of sites scoring better than the average of aligned sites = 3 Number in coding regions = 1 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 5 aaagattcgcgaatattctgtgatttttcg 2 94 0 gaatattctg 0.986951 -207 gaatattcgcgaatctttcggaaaagacac 2 106 1 gaatctttcg 0.975463 -195 gggttttgccggacatcccgagtaaaatcc 2 154 0 ggacatcccg 0.96107 -147 aattattggcgaacattcgggggttttgcc 2 174 0 gaacattcgg 0.985691 -127 gattacctcggaaaattttgttacaattat 2 220 0 gaaaattttg 0.933778 -81 gcgaaatttcgaatatttcgaaattttttt 2 272 1 gaatatttcg 0.990513 -29 ********** Masking position 6 Map Score: 6.56156 Number of sites scoring better than the average of aligned sites = 19 Number in coding regions = 17 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 6 accgattagtaattattgcc 1 1 0 aattattgcc 0.944075 -23 accaattctctatttgcgacttacgaaaaa 2 31 0 tatttgcgac 0.834922 -270 gcaaatagagaattggtggccaaacttatc 2 44 1 aattggtggc 0.968074 -257 atattctgtgatttttcggcaaaatcgtcg 2 82 0 atttttcggc 0.953294 -219 attttgttacaattattggcgaacattcgg 2 184 0 aattattggc 0.979472 -117 attttgttacaattattggacaattttgtt 2 206 0 aattattgga 0.930857 -95 attgtaacaaaattttccgaggtaatcgag 2 223 1 aattttccga 0.841262 -78 aatttcgccaaaattgtgacgtttttactc 2 250 0 aaattgtgac 0.862366 -51 gaaatattcgaaatttcgccaaaattgtga 2 261 0 aaatttcgcc 0.934494 -40 aatttgcggaaaaaaatttc 2 291 0 aatttgcgga 0.977945 -10 ********** Masking position 4 Map Score: 11.8296 Number of sites scoring better than the average of aligned sites = 238 Number in coding regions = 193 Number in noncoding regions = 45 Number of orfs with sites within 600 bp upstream = 41 Fraction of orfs with sites within 600 bp upstream = 0.00658529 Motif number 7 ********** No masking Map Score: -4.38104e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -4.38104e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: -4.38104e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0