AlignACE version 2.2  July 7, 1998
/home/amcguire/bin/alignACE -i193_dna_polymerase_mpneu_reg_300.orf -o193_mpneu_300.ace -a/home/amcguire/alignace/lib/ORF_mpneu.txt -z/skink1/amcguire/genomes/mpneu.fna -g0.40 -x5 -e 
Parameter values:
 expect =  	5
 ncols =   	10
 npass =   	1000
 maxnpass =	100
 nruns =   	1000
 maxnruns =	100
 repeat =  	15
 maxreps = 	3
 nread =   	500
 ncycles = 	1
 fragment =	1
 psfact =  	0.1
 gcback =  	0.4
 maxlen =  	30
 weight =  	0.8
 exclude = 	1

Input sequences:
#1	RMP00460	300	Mycoplasma_pneumoniae

Motif number 1

tctttgatcttctcaacttttttcttaacc	1	195	1	tctcaacttt	    0.996639	-106
tcaacttttttcttaaccttttgtggaaac	1	207	1	tcttaacctt	    0.996639	-94
cggtgcatggtcttaactttaatttgcact	1	238	1	tcttaacttt	     0.99481	-63
cactttagtttctcaaccttgcatttgatt	1	264	1	tctcaacctt	    0.997824	-37
          **********

Masking position 5
Map Score:   9.76688

Number of sites scoring better than the average of aligned sites = 1
Number in coding regions = 1
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 2

ctaaacgcgtcaagagtctctaaattatctt   	1	8	0	caagagttaa	    0.935367	-293
agactcttgacgcgtttagaaataattttaatcg	1	23	1	cgcgtttaaa	    0.954303	-278
gttgtgtcagcgagattatgtacagtttcctatt	1	63	1	cgagatttaa	     0.98981	-238
ccaagttcgacaagttggaataaaaaaaatagga	1	90	0	caagttgtaa	    0.986441	-211
tcgaatcaggcgagtttttccagatgaccaagtt	1	117	0	cgagtttcaa	    0.994627	-184
tacagtagatcaagttgtagtaaattttgaaccc	1	159	0	caagttgtaa	    0.986441	-142
gaccatgcaccgagtttccacaaaaggttaagaa	1	216	0	cgagtttcaa	    0.994623	-85
          *******   ** *

Masking position 12
Map Score:   7.73662

Number of sites scoring better than the average of aligned sites = 35
Number in coding regions = 30
Number in noncoding regions = 5
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 3

gacacaacttcagtcgattaaaattatttct	1	40	0	cagcgattaa	    0.981584	-261
cgagtttttccagatgaccaagttcgacaag	1	110	0	cagtgaccaa	    0.988235	-191
tttgaacccacaggagatcgaatcaggcgag	1	137	0	cagagatcga	    0.995339	-164
caaagaactacagtagatcaagttgtagtaa	1	170	0	cagagatcaa	    0.997895	-131
gaaaaaagttgagaagatcaaagaactacag	1	188	0	gagagatcaa	    0.992625	-113
          *** *******

Masking position 7
Map Score:   7.3893

Number of sites scoring better than the average of aligned sites = 7
Number in coding regions = 6
Number in noncoding regions = 1
Number of orfs with sites within 600 bp upstream = 1
Fraction of orfs with sites within 600 bp upstream = 0.000160617


Motif number 4

attttaatcgactgaagttgtgtcagcgag	1	47	1	actgaagttg	    0.979537	-254
aacttgatctactgtagttctttgatcttc	1	177	1	actgtagttc	    0.991799	-124
catggtcttaactttaatttgcactttagt	1	243	1	actttaattt	    0.958663	-58
tttaatttgcactttagtttctcaaccttg	1	255	1	actttagttt	    0.989313	-46
          **********

Masking position 6
Map Score:   2.74331

Number of sites scoring better than the average of aligned sites = 26
Number in coding regions = 24
Number in noncoding regions = 2
Number of orfs with sites within 600 bp upstream = 1
Fraction of orfs with sites within 600 bp upstream = 0.000160617


Motif number 5

aattatttctaaacgcgtcaagagtctcta	1	20	0	aaacgcgtca	    0.919785	-281
aactgtacataatctcgctgacacaacttc	1	60	0	aatctcgctg	    0.972603	-241
ttttttattccaacttgtcgaacttggtca	1	97	1	caacttgtcg	    0.933764	-204
tcatctggaaaaactcgcctgattcgatct	1	124	1	aaactcgcct	    0.984377	-177
ccttttgtggaaactcggtgcatggtctta	1	223	1	aaactcggtg	    0.972574	-78
          **********

Masking position 2
Map Score:   1.2128

Number of sites scoring better than the average of aligned sites = 49
Number in coding regions = 42
Number in noncoding regions = 7
Number of orfs with sites within 600 bp upstream = 4
Fraction of orfs with sites within 600 bp upstream = 0.000642467


Motif number 6

          **********

No masking
Map Score:   7.91135e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 7

          **********

No masking
Map Score:   7.91135e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 8

          **********

No masking
Map Score:   7.91135e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0