AlignACE version 2.2  July 7, 1998
/home/amcguire/bin/alignACE -i194_dna_replication_mpneu_reg_100.orf -o194_mpneu_100.ace -a/home/amcguire/alignace/lib/ORF_mpneu.txt -z/skink1/amcguire/genomes/mpneu.fna -g0.40 -x5 -e 
Parameter values:
 expect =  	5
 ncols =   	10
 npass =   	1000
 maxnpass =	100
 nruns =   	1000
 maxnruns =	100
 repeat =  	15
 maxreps = 	3
 nread =   	500
 ncycles = 	1
 fragment =	1
 psfact =  	0.1
 gcback =  	0.4
 maxlen =  	30
 weight =  	0.8
 exclude = 	1

Input sequences:
#1	RMP00221	157	Mycoplasma_pneumoniae
#2	RMP00223	45	Mycoplasma_pneumoniae

Motif number 1

attagttaacagcccacttaaggtggttgt	1	39	1	agcccactta	    0.993174	-119
ccacaaaatcagcccccaaacttataataa	1	79	0	agcccccaaa	    0.989453	-79
caaggggtgaaccccacaaaatcagccccc	1	92	0	accccacaaa	    0.994355	-66
ataagaaattagcccagtcaaggggtgaac	1	110	0	agcccagtca	    0.995372	-48
tactagggtcatcccagtaacaa       	2	4	0	atcccagtaa	    0.991762	-42
tactgggatgaccctagtactaaaatcaat	2	15	1	accctagtac	    0.948947	-31
          **********

Masking position 1
Map Score:   9.17933

Number of sites scoring better than the average of aligned sites = 84
Number in coding regions = 75
Number in noncoding regions = 9
Number of orfs with sites within 600 bp upstream = 6
Fraction of orfs with sites within 600 bp upstream = 0.000963701


Motif number 2

aacaaccaccttaagtgggctgttaactaa	1	40	0	ttaagtgggc	    0.993641	-118
tttattataagtttgggggctgattttgtg	1	78	1	gtttgggggc	    0.992592	-80
tgggggctgattttgtggggttcacccctt	1	91	1	ttttgtgggg	    0.990365	-67
ggttcaccccttgactgggctaatttctta	1	109	1	ttgactgggc	    0.993749	-49
        ttgttactgggatgaccctagt	2	3	1	gttactggga	    0.986603	-43
          **********

Masking position 2
Map Score:   5.79437

Number of sites scoring better than the average of aligned sites = 37
Number in coding regions = 28
Number in noncoding regions = 9
Number of orfs with sites within 600 bp upstream = 7
Fraction of orfs with sites within 600 bp upstream = 0.00112432


Motif number 3

tgactttgatagttattagtaattaattag	1	14	1	agttattagt	    0.942114	-144
gttattagtaattaattagttaacagccca	1	25	1	attaattagt	     0.87024	-133
gttgttttggtttatttattataagtttgg	1	64	1	tttatttatt	    0.910314	-94
gactgggctaatttcttattttgttataat	1	121	1	atttcttatt	    0.908521	-37
tttcttattttgttataattcaacaagtat	1	132	1	tgttataatt	     0.92049	-26
taattcaacaagtattaattc         	1	147	1	agtattaatt	     0.91796	-11
ttagtcttattgattttagtactagggtca	2	23	0	tgattttagt	    0.872701	-23
          **********

Masking position 8
Map Score:   3.81629

Number of sites scoring better than the average of aligned sites = 327
Number in coding regions = 229
Number in noncoding regions = 98
Number of orfs with sites within 600 bp upstream = 77
Fraction of orfs with sites within 600 bp upstream = 0.0123675


Motif number 4

          **********

No masking
Map Score:   -4.73059e-14

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 5

          **********

No masking
Map Score:   -4.73059e-14

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 6

          **********

No masking
Map Score:   -4.73059e-14

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0