AlignACE version 2.2  July 7, 1998
/home/amcguire/bin/alignACE -i196_mixed_replication_rec__mpneu_reg_300.orf -o196_mpneu_300.ace -a/home/amcguire/alignace/lib/ORF_mpneu.txt -z/skink1/amcguire/genomes/mpneu.fna -g0.40 -x5 -e 
Parameter values:
 expect =  	5
 ncols =   	10
 npass =   	1000
 maxnpass =	100
 nruns =   	1000
 maxnruns =	100
 repeat =  	15
 maxreps = 	3
 nread =   	500
 ncycles = 	1
 fragment =	1
 psfact =  	0.1
 gcback =  	0.4
 maxlen =  	30
 weight =  	0.8
 exclude = 	1

Input sequences:
#1	RMP00573	36	Mycoplasma_pneumoniae
#2	RMP00575	16	Mycoplasma_pneumoniae
#3	RMP00579	300	Mycoplasma_pneumoniae

Motif number 1

         cttttttgacccttaa       	2	2	1	tttttgacct	    0.981103	-15
actacgtaaccttttggttcgtcaaccatcga	3	114	1	cttttgtcgt	    0.973082	-187
gtgtgtctttttgttcgatggttgacgaacca	3	128	0	ttgttgaggt	    0.989579	-173
ggaacaaccgttgttagtgtgtctttttgttc	3	144	0	ttgttgttgt	    0.938077	-157
actgaaactttgttttgatggtcgaccgagat	3	180	1	tgtttgaggt	    0.977494	-121
aaaaaacgtgtttttcgaccgcgttaagcaaa	3	213	0	tttttgacgc	    0.988108	-88
aaaaacacgttttttagaacgtttgtcaactt	3	230	1	tttttgacgt	     0.99631	-71
          ***** ** ***

Masking position 5
Map Score:   7.91197

Number of sites scoring better than the average of aligned sites = 61
Number in coding regions = 56
Number in noncoding regions = 5
Number of orfs with sites within 600 bp upstream = 5
Fraction of orfs with sites within 600 bp upstream = 0.000803084


Motif number 2

tatcaatatcagttcggttgtt         	1	25	1	attcggttgt	    0.977684	-12
cgcaatccaaattacgtttttgagttacaac	3	49	1	atacgttttt	    0.983534	-252
agacacactaacaacggttgttccgaatact	3	152	1	aaacggttgt	    0.539104	-149
gcggtcgaaaaacacgttttttagaacgttt	3	223	1	acacgttttt	    0.976175	-78
cacgttttttagaacgtttgtcaacttgtgt	3	235	1	aaacgtttgt	    0.981193	-66
          * *********

Masking position 8
Map Score:   5.7204

Number of sites scoring better than the average of aligned sites = 26
Number in coding regions = 23
Number in noncoding regions = 3
Number of orfs with sites within 600 bp upstream = 3
Fraction of orfs with sites within 600 bp upstream = 0.00048185


Motif number 3

attgatatttatttccaattg         	1	2	0	atttccaatt	    0.929748	-35
actttaccgcaatccaaattacgtttttga	3	42	1	aatccaaatt	    0.981979	-259
acttgtgtaaaattcactttaaagaatcca	3	258	1	aattcacttt	    0.935486	-43
cactttaaagaatccaatttattccaaatt	3	272	1	aatccaattt	     0.98609	-29
aatccaatttattccaaattctcttgttc 	3	282	1	attccaaatt	     0.98609	-19
          **********

Masking position 3
Map Score:   5.10921

Number of sites scoring better than the average of aligned sites = 38
Number in coding regions = 36
Number in noncoding regions = 2
Number of orfs with sites within 600 bp upstream = 3
Fraction of orfs with sites within 600 bp upstream = 0.00048185


Motif number 4

cttttggttcgtcaaccatcgaacaaaaag	3	124	1	gtcaaccatc	    0.988726	-177
aaagatctcggtcgaccatcaaaacaaagt	3	186	0	gtcgaccatc	    0.995221	-115
gcttaacgcggtcgaaaaacacgtttttta	3	216	1	gtcgaaaaac	    0.981326	-85
ttttacacaagttgacaaacgttctaaaaa	3	240	0	gttgacaaac	    0.961571	-61
          **********

Masking position 5
Map Score:   4.30346

Number of sites scoring better than the average of aligned sites = 14
Number in coding regions = 14
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 5

ataacacaagcactttaccgcaatccaaat	3	31	1	cactttaccg	    0.992379	-270
tttgagttacaactataacggcaccggacg	3	67	1	aactataacg	    0.971752	-234
gtgtaaaattcactttaaagaatccaattt	3	262	1	cactttaaag	    0.983421	-39
          **********

Masking position 7
Map Score:   0.030282

Number of sites scoring better than the average of aligned sites = 10
Number in coding regions = 10
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 6

          **********

No masking
Map Score:   -6.15168e-14

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 7

          **********

No masking
Map Score:   -6.15168e-14

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 8

          **********

No masking
Map Score:   -6.15168e-14

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0