AlignACE version 2.2  July 7, 1998
/home/amcguire/bin/alignACE -i207_holliday_junction_mpneu_reg_300.orf -o207_mpneu_300.ace -a/home/amcguire/alignace/lib/ORF_mpneu.txt -z/skink1/amcguire/genomes/mpneu.fna -g0.40 -x5 -e 
Parameter values:
 expect =  	5
 ncols =   	10
 npass =   	1000
 maxnpass =	100
 nruns =   	1000
 maxnruns =	100
 repeat =  	15
 maxreps = 	3
 nread =   	500
 ncycles = 	1
 fragment =	1
 psfact =  	0.1
 gcback =  	0.4
 maxlen =  	30
 weight =  	0.8
 exclude = 	1

Input sequences:
#1	RMP00309	300	Mycoplasma_pneumoniae

Motif number 1

taactgtcaataatctcttttttactcctg   	1	8	0	taatcctttt	    0.981262	-293
tattgacagttactcacgattttgaagtatata	1	29	1	tactccattt	    0.981053	-272
cttctctatttcatctcttattatggatgtcga	1	80	0	tcatccttta	    0.959985	-221
ttaatgggggtactcccttctctatttcatctc	1	96	0	tactccttct	    0.987867	-205
ttaaccacattcattactattctggaattagta	1	125	1	tcattcatct	    0.913924	-176
ctaacttcgatcatgttttttctgttactaatt	1	150	0	tcatgtttct	    0.852382	-151
acttacacattcctcttaaatttcgcggtttga	1	252	0	tcctctattt	    0.968049	-49
agtaaatctatcctcgcttatttacacat    	1	282	1	tcctcctttt	    0.995316	-19
          ***** * * ***

Masking position 4
Map Score:   7.42103

Number of sites scoring better than the average of aligned sites = 101
Number in coding regions = 79
Number in noncoding regions = 22
Number of orfs with sites within 600 bp upstream = 19
Fraction of orfs with sites within 600 bp upstream = 0.00305172


Motif number 2

       caggagtaaaaaagagattattg	1	4	1	gagtaaaaaa	    0.962219	-297
cacgattttgaagtatataacaccgacgac	1	43	1	aagtatataa	    0.866068	-258
tactattctggaattagtaacagaaaaaac	1	139	1	gaattagtaa	    0.888586	-162
aacatgatcgaagttagtagtaataattgc	1	166	1	aagttagtag	    0.805709	-135
ggacacaaaaaacttaataaatggacaagt	1	196	1	aacttaataa	     0.80532	-105
aactgatgcaaagaaaaaaacttgtccatt	1	215	0	aagaaaaaaa	     0.80378	-86
ttcgcggtttgaaaaaataaactgatgcaa	1	234	0	gaaaaaataa	    0.853483	-67
taagaggaatgtgtaagtaaatctatcctc	1	267	1	gtgtaagtaa	    0.954559	-34
        atgtgtaaataagcgaggatag	1	289	0	gtgtaaataa	    0.962192	-12
          **********

Masking position 9
Map Score:   4.94301

Number of sites scoring better than the average of aligned sites = 343
Number in coding regions = 280
Number in noncoding regions = 63
Number of orfs with sites within 600 bp upstream = 50
Fraction of orfs with sites within 600 bp upstream = 0.00803084


Motif number 3

          **********

No masking
Map Score:   7.91135e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 4

          **********

No masking
Map Score:   7.91135e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 5

          **********

No masking
Map Score:   7.91135e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0