AlignACE version 2.2  July 7, 1998
/home/amcguire/bin/alignACE -i209_rpod_mpneu_reg_100.orf -o209_mpneu_100.ace -a/home/amcguire/alignace/lib/ORF_mpneu.txt -z/skink1/amcguire/genomes/mpneu.fna -g0.40 -x5 -e 
Parameter values:
 expect =  	5
 ncols =   	10
 npass =   	1000
 maxnpass =	100
 nruns =   	1000
 maxnruns =	100
 repeat =  	15
 maxreps = 	3
 nread =   	500
 ncycles = 	1
 fragment =	1
 psfact =  	0.1
 gcback =  	0.4
 maxlen =  	30
 weight =  	0.8
 exclude = 	1

Input sequences:
#1	RMP00480	167	Mycoplasma_pneumoniae
#2	RMP00483	21	Mycoplasma_pneumoniae
#3	RMP00485	52	Mycoplasma_pneumoniae

Motif number 1

gttatgttctgccattgaactatatctgcg	1	40	0	gccattgaac	     0.99263	-128
gcagataacgggaatcgaacccgcatctta	1	81	0	ggaatcgaac	    0.992747	-87
gcacctggttggcattgtaagctaatcagg	1	133	1	ggcattgtaa	    0.989116	-35
cacgccaagtggaattgtacattat     	3	6	0	ggaattgtac	    0.995712	-47
          **********

Masking position 5
Map Score:   5.22081

Number of sites scoring better than the average of aligned sites = 24
Number in coding regions = 15
Number in noncoding regions = 9
Number of orfs with sites within 600 bp upstream = 8
Fraction of orfs with sites within 600 bp upstream = 0.00128493


Motif number 2

ttaatatactaaaattatgagctgcgcaga	1	16	1	aaaattatga	    0.950372	-152
taaccttggcaaggttatgttctgccattg	1	53	0	aaggttatgt	    0.978977	-115
taaccttgccaaggttaagatgcgggttcg	1	66	1	aaggttaaga	    0.989652	-102
gcttttaggaaaatttaatatggagcagat	1	105	0	aaatttaata	    0.873447	-63
     tttttaagattaattaacact    	2	6	1	aagattaatt	    0.950362	-16
          **********

Masking position 5
Map Score:   2.91113

Number of sites scoring better than the average of aligned sites = 115
Number in coding regions = 93
Number in noncoding regions = 22
Number of orfs with sites within 600 bp upstream = 23
Fraction of orfs with sites within 600 bp upstream = 0.00369419


Motif number 3

taacgggaatcgaacccgcatcttaacctt	1	76	0	cgaacccgca	    0.993821	-92
cgcgtatacacgcacgccaagtggaattgt	3	18	0	cgcacgccaa	    0.996573	-35
cagtctagtgcgcacgcgtatacacgcacg	3	32	0	cgcacgcgta	    0.996685	-21
          **********

Masking position 4
Map Score:   1.95165

Number of sites scoring better than the average of aligned sites = 4
Number in coding regions = 3
Number in noncoding regions = 1
Number of orfs with sites within 600 bp upstream = 1
Fraction of orfs with sites within 600 bp upstream = 0.000160617


Motif number 4

ctatatctgcgcagctcataattttagtat	1	21	0	gcagctcata	     0.99557	-147
tagttcaatggcagaacataaccttgccaa	1	48	1	gcagaacata	    0.993169	-120
aatttaatatggagcagataacgggaatcg	1	94	0	ggagcagata	    0.991541	-74
          **********

Masking position 3
Map Score:   1.7335

Number of sites scoring better than the average of aligned sites = 6
Number in coding regions = 5
Number in noncoding regions = 1
Number of orfs with sites within 600 bp upstream = 2
Fraction of orfs with sites within 600 bp upstream = 0.000321234


Motif number 5

agcttacaatgccaaccaggtgcttttagg	1	126	0	gccaaccagg	    0.997808	-42
ggcattgtaagctaatcagggctttttatt	1	143	1	gctaatcagg	    0.974887	-25
          **********

Masking position 5
Map Score:   0.106066

Number of sites scoring better than the average of aligned sites = 3
Number in coding regions = 2
Number in noncoding regions = 1
Number of orfs with sites within 600 bp upstream = 2
Fraction of orfs with sites within 600 bp upstream = 0.000321234


Motif number 6

          **********

No masking
Map Score:   1.3033e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 7

          **********

No masking
Map Score:   1.3033e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 8

          **********

No masking
Map Score:   1.3033e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0