AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i210_trans4_mpneu_reg_100.orf -o210_mpneu_100.ace -a/home/amcguire/alignace/lib/ORF_mpneu.txt -z/skink1/amcguire/genomes/mpneu.fna -g0.40 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.4 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMP00221 157 Mycoplasma_pneumoniae #2 RMP00323 42 Mycoplasma_pneumoniae #3 RMP00677 300 Mycoplasma_pneumoniae Motif number 1 attagttaacagcccacttaaggtggttgtt 1 39 1 agcccactaa 0.996709 -119 ccacaaaatcagcccccaaacttataataaa 1 78 0 agcccccaac 0.992456 -80 caaggggtgaaccccacaaaatcagccccca 1 91 0 accccacaaa 0.99005 -67 ataagaaattagcccagtcaaggggtgaacc 1 109 0 agcccagtaa 0.985804 -49 tcgtagttgatgcccacctaaatcgcgtttg 3 131 1 tgcccaccaa 0.984326 -170 gtgatggtccagcccccataataaattcaca 3 161 1 agcccccaaa 0.997228 -140 ******** ** Masking position 10 Map Score: 9.6782 Number of sites scoring better than the average of aligned sites = 16 Number in coding regions = 11 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 2 agatgactttgatagttattagtaattaatt 1 8 1 ttatgttata 0.969679 -150 ttattagtaattaattagttaacagcccacttaa 1 26 1 ttttgttaaa 0.969687 -132 gttgttttggtttatttattataagtttgggggc 1 64 1 ttttattata 0.977611 -94 ggctaatttcttattttgttataattcaacaagt 1 126 1 ttttgttata 0.986041 -32 cagatagaagttagttaaatattaataaaattac 2 11 1 ttttaatata 0.915288 -32 ggaaaggaaatttgttcgttattacactagatcg 3 270 0 ttttgttata 0.992336 -31 ** ** ***** * Masking position 6 Map Score: 5.80065 Number of sites scoring better than the average of aligned sites = 8 Number in coding regions = 3 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 3 caaccaccttaagtgggctgttaactaatt 1 38 0 aagtgggctg 0.991589 -120 tattataagtttgggggctgattttgtggg 1 80 1 ttgggggctg 0.995575 -78 ggggctgattttgtggggttcaccccttga 1 93 1 ttgtggggtt 0.963337 -65 aacgcgatttaggtgggcatcaactacgag 3 130 0 aggtgggcat 0.959365 -171 tgaatttattatgggggctggaccatcaca 3 160 0 atgggggctg 0.996901 -141 ********** Masking position 5 Map Score: 5.10764 Number of sites scoring better than the average of aligned sites = 24 Number in coding regions = 18 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 4 aagtgtgatacgtttcaaccgcggttacaaatc 3 47 1 cgtttacgcg 0.997029 -254 aaatgttctgcgttttcatcgccgaatcgtttt 3 93 0 cgtttacgcc 0.987178 -208 aaacgcagaacattttaatctcgtagttgatgc 3 111 1 catttactcg 0.992682 -190 ggggctggaccatcacaaacgcgatttaggtgg 3 144 0 catcaacgcg 0.977646 -157 acatcgacgaaattttgacctcgcctttttgaa 3 189 1 aatttactcg 0.954631 -112 gacaagactgcgtctcgatctagtgtaataacg 3 255 1 cgtctactag 0.964824 -46 ***** * **** Masking position 8 Map Score: 3.44761 Number of sites scoring better than the average of aligned sites = 31 Number in coding regions = 27 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 5 taacaaaataagaaattagcccagtcaagg 1 117 0 agaaattagc 0.949518 -41 cagatagaagttagttaaatattaa 2 6 1 agaagttagt 0.9319 -37 aggcgaggtcaaaatttcgtcgatgtgaat 3 185 0 aaaatttcgt 0.925351 -116 tcgcctttttgaaatttcgtgacaatgttt 3 209 1 gaaatttcgt 0.951193 -92 cttgtcgaatggaaattcgcaaaaacattg 3 231 0 ggaaattcgc 0.984465 -70 gaaagggaaaggaaatttgttcgttattac 3 279 0 ggaaatttgt 0.94003 -22 ********** Masking position 6 Map Score: 3.41049 Number of sites scoring better than the average of aligned sites = 59 Number in coding regions = 49 Number in noncoding regions = 10 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 6 ttttgttataattcaacaagtattaattc 1 139 1 attcaacaag 0.982744 -19 gccgaatcgttttctgaaagaccattgatt 3 76 0 tttctgaaag 0.924638 -225 tgtcacgaaatttcaaaaaggcgaggtcaa 3 203 0 tttcaaaaag 0.973595 -98 gcgaatttccattcgacaagactgcgtctc 3 241 1 attcgacaag 0.97955 -60 ********** Masking position 3 Map Score: 0.648198 Number of sites scoring better than the average of aligned sites = 54 Number in coding regions = 45 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 9 Fraction of orfs with sites within 600 bp upstream = 0.00144555 Motif number 7 ********** No masking Map Score: -8.78641e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -8.78641e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: -8.78641e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0