AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i210_trans4_mpneu_reg_300.orf -o210_mpneu_300.ace -a/home/amcguire/alignace/lib/ORF_mpneu.txt -z/skink1/amcguire/genomes/mpneu.fna -g0.40 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.4 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMP00221 157 Mycoplasma_pneumoniae #2 RMP00323 42 Mycoplasma_pneumoniae #3 RMP00677 300 Mycoplasma_pneumoniae Motif number 1 aacaaccaccttaagtgggctgttaactaat 1 39 0 ttagtgggct 0.997731 -119 tttattataagtttgggggctgattttgtgg 1 78 1 gttgggggct 0.989362 -80 tgggggctgattttgtggggttcaccccttg 1 91 1 tttgtggggt 0.985984 -67 ggttcaccccttgactgggctaatttcttat 1 109 1 ttgctgggct 0.983369 -49 caaacgcgatttaggtgggcatcaactacga 3 131 0 ttagtgggca 0.990864 -170 tgtgaatttattatgggggctggaccatcac 3 161 0 ttagggggct 0.997264 -140 *** ******* Masking position 2 Map Score: 9.6782 Number of sites scoring better than the average of aligned sites = 12 Number in coding regions = 8 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 2 agatgactttgatagttattagtaattaatt 1 8 1 ttatgttata 0.973929 -150 ttattagtaattaattagttaacagcccacttaa 1 26 1 ttttgttaaa 0.973938 -132 gttgttttggtttatttattataagtttgggggc 1 64 1 ttttattata 0.98075 -94 ggctaatttcttattttgttataattcaacaagt 1 126 1 ttttgttata 0.986083 -32 cagatagaagttagttaaatattaataaaattac 2 11 1 ttttaatata 0.92658 -32 ggaaaggaaatttgttcgttattacactagatcg 3 270 0 ttttgttata 0.993429 -31 ** ** ***** * Masking position 6 Map Score: 5.80065 Number of sites scoring better than the average of aligned sites = 8 Number in coding regions = 3 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 3 caaccaccttaagtgggctgttaactaatt 1 38 0 aagtgggctg 0.99046 -120 tattataagtttgggggctgattttgtggg 1 80 1 ttgggggctg 0.994975 -78 ggggctgattttgtggggttcaccccttga 1 93 1 ttgtggggtt 0.95855 -65 aacgcgatttaggtgggcatcaactacgag 3 130 0 aggtgggcat 0.954095 -171 tgaatttattatgggggctggaccatcaca 3 160 0 atgggggctg 0.996483 -141 ********** Masking position 5 Map Score: 5.10764 Number of sites scoring better than the average of aligned sites = 24 Number in coding regions = 18 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 4 aagtgtgatacgtttcaaccgcggttacaaatc 3 47 1 ctttcacgcg 0.996997 -254 aaatgttctgcgttttcatcgccgaatcgtttt 3 93 0 cttttacgcc 0.968672 -208 aaacgcagaacattttaatctcgtagttgatgc 3 111 1 cttttactcg 0.992544 -190 ggggctggaccatcacaaacgcgatttaggtgg 3 144 0 ctcacacgcg 0.978908 -157 acatcgacgaaattttgacctcgcctttttgaa 3 189 1 attttactcg 0.945291 -112 gacaagactgcgtctcgatctagtgtaataacg 3 255 1 ctctcactag 0.960015 -46 gaacaaatttcctttccctttcgc 3 287 1 ctttccttcg 0.916532 -14 * **** * **** Masking position 3 Map Score: 3.68799 Number of sites scoring better than the average of aligned sites = 57 Number in coding regions = 49 Number in noncoding regions = 8 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 5 tgatttgtaaccgcggttgaaacgtatcac 3 51 0 ccgcggttga 0.978681 -250 agaaaacgattcggcgatgaaaacgcagaa 3 91 1 tcggcgatga 0.964964 -210 cattttaatctcgtagttgatgcccaccta 3 121 1 tcgtagttga 0.950524 -180 cccacctaaatcgcgtttgtgatggtccag 3 143 1 tcgcgtttgt 0.976975 -158 ggtcaaaatttcgtcgatgtgaatttatta 3 179 0 tcgtcgatgt 0.973818 -122 aattttgacctcgcctttttgaaatttcgt 3 199 1 tcgccttttt 0.905319 -102 ********** Masking position 8 Map Score: 1.68285 Number of sites scoring better than the average of aligned sites = 86 Number in coding regions = 78 Number in noncoding regions = 8 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 6 tgactttgatagttattagtaattaattag 1 14 1 agttattagt 0.880711 -144 gttattagtaattaattagttaacagccca 1 25 1 attaattagt 0.800809 -133 taacaaaataagaaattagcccagtcaagg 1 117 0 agaaattagc 0.97762 -41 cagatagaagttagttaaatattaa 2 6 1 agaagttagt 0.953477 -37 gctagagatcagcaattagattggtaaagt 3 21 1 agcaattaga 0.901678 -280 cttgtcgaatggaaattcgcaaaaacattg 3 231 0 ggaaattcgc 0.931361 -70 gaaagggaaaggaaatttgttcgttattac 3 279 0 ggaaatttgt 0.907587 -22 ********** Masking position 6 Map Score: 2.15684 Number of sites scoring better than the average of aligned sites = 121 Number in coding regions = 97 Number in noncoding regions = 24 Number of orfs with sites within 600 bp upstream = 22 Fraction of orfs with sites within 600 bp upstream = 0.00353357 Motif number 7 ttaatacttgttgaattataacaaaataaga 1 134 0 tgaattataa 0.934961 -24 gatcagcaattagattggtaaagtgtgatac 3 27 1 tgattggtaa 0.98882 -274 tgaaagaccattgatttgtaaccgcggttga 3 61 0 tgatttgtaa 0.982802 -240 cgcagtcttgtcgaatggaaattcgcaaaaa 3 236 0 tgaatggaaa 0.972226 -65 * ********* Masking position 6 Map Score: 0.0327569 Number of sites scoring better than the average of aligned sites = 25 Number in coding regions = 21 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 8 ********** No masking Map Score: -8.78641e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: -8.78641e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 10 ********** No masking Map Score: -8.78641e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0