AlignACE version 2.2  July 7, 1998
/home/amcguire/bin/alignACE -i214_Ribosomal_Operon_1_mpneu_reg_300.orf -o214_mpneu_300.ace -a/home/amcguire/alignace/lib/ORF_mpneu.txt -z/skink1/amcguire/genomes/mpneu.fna -g0.40 -x5 -e 
Parameter values:
 expect =  	5
 ncols =   	10
 npass =   	1000
 maxnpass =	100
 nruns =   	1000
 maxnruns =	100
 repeat =  	15
 maxreps = 	3
 nread =   	500
 ncycles = 	1
 fragment =	1
 psfact =  	0.1
 gcback =  	0.4
 maxlen =  	30
 weight =  	0.8
 exclude = 	1

Input sequences:
#1	RMP00221	157	Mycoplasma_pneumoniae
#2	RMP00223	45	Mycoplasma_pneumoniae
#3	RMP00226	30	Mycoplasma_pneumoniae

Motif number 1

attagttaacagcccacttaaggtggttgt	1	39	1	agcccactta	     0.99239	-119
ccacaaaatcagcccccaaacttataataa	1	79	0	agcccccaaa	    0.988247	-79
caaggggtgaaccccacaaaatcagccccc	1	92	0	accccacaaa	    0.993705	-66
ataagaaattagcccagtcaaggggtgaac	1	110	0	agcccagtca	    0.994842	-48
tactagggtcatcccagtaacaa       	2	4	0	atcccagtaa	    0.990819	-42
tactgggatgaccctagtactaaaatcaat	2	15	1	accctagtac	    0.943373	-31
          **********

Masking position 1
Map Score:   8.50045

Number of sites scoring better than the average of aligned sites = 84
Number in coding regions = 75
Number in noncoding regions = 9
Number of orfs with sites within 600 bp upstream = 6
Fraction of orfs with sites within 600 bp upstream = 0.000963701


Motif number 2

aacaaccaccttaagtgggctgttaactaa	1	40	0	ttaagtgggc	    0.991981	-118
tttattataagtttgggggctgattttgtg	1	78	1	gtttgggggc	     0.99066	-80
tgggggctgattttgtggggttcacccctt	1	91	1	ttttgtgggg	     0.98786	-67
ggttcaccccttgactgggctaatttctta	1	109	1	ttgactgggc	    0.992118	-49
        ttgttactgggatgaccctagt	2	3	1	gttactggga	    0.983137	-43
          **********

Masking position 2
Map Score:   5.22895

Number of sites scoring better than the average of aligned sites = 37
Number in coding regions = 28
Number in noncoding regions = 9
Number of orfs with sites within 600 bp upstream = 7
Fraction of orfs with sites within 600 bp upstream = 0.00112432


Motif number 3

atgactttgatagttattagtaattaatta	1	13	1	tagttattag	    0.934326	-145
tttggtttatttattataagtttgggggct	1	69	1	ttattataag	    0.977543	-89
atttcttattttgttataattcaacaagta	1	131	1	ttgttataat	    0.962236	-27
          ttgttactgggatgacccta	2	1	1	ttgttactgg	    0.934149	-45
cttattgattttagtactagggtcatccca	2	18	0	ttagtactag	    0.919332	-28
       cccttagtcttattgattttagt	2	33	0	ttagtcttat	    0.925435	-13
aaactgcttattattctaattta       	3	4	0	ttattctaat	    0.934206	-27
          **********

Masking position 5
Map Score:   4.80646

Number of sites scoring better than the average of aligned sites = 197
Number in coding regions = 162
Number in noncoding regions = 35
Number of orfs with sites within 600 bp upstream = 29
Fraction of orfs with sites within 600 bp upstream = 0.00465789


Motif number 4

 agatgactttgatagttattagtaattaa	1	10	1	tgatagttat	    0.875242	-148
ccacttaaggtggttgttttggtttattta	1	52	1	tggttgtttt	    0.987962	-106
ctgggctaatttcttattttgttataattc	1	123	1	ttcttatttt	    0.946339	-35
gaattaatacttgttgaattataacaaaat	1	138	0	ttgttgaatt	    0.873438	-20
 cccttagtcttattgattttagtactagg	2	27	0	ttattgattt	    0.947561	-19
ttaacaaaactgcttattattctaattta 	3	10	0	tgcttattat	    0.936958	-21
          **********

Masking position 4
Map Score:   2.03575

Number of sites scoring better than the average of aligned sites = 515
Number in coding regions = 456
Number in noncoding regions = 59
Number of orfs with sites within 600 bp upstream = 44
Fraction of orfs with sites within 600 bp upstream = 0.00706714


Motif number 5

          **********

No masking
Map Score:   -1.32571e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 6

          **********

No masking
Map Score:   -1.32571e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 7

          **********

No masking
Map Score:   -1.32571e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0