AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i216_Ribosomal_Operon_3_mpneu_reg_300.orf -o216_mpneu_300.ace -a/home/amcguire/alignace/lib/ORF_mpneu.txt -z/skink1/amcguire/genomes/mpneu.fna -g0.40 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.4 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMP00094 55 Mycoplasma_pneumoniae #2 RMP00178 84 Mycoplasma_pneumoniae #3 RMP00179 158 Mycoplasma_pneumoniae #4 RMP00182 150 Mycoplasma_pneumoniae #5 RMP00183 81 Mycoplasma_pneumoniae #6 RMP00184 65 Mycoplasma_pneumoniae Motif number 1 agtttgagataaagctgtagagaggcttat 2 35 0 aaagctgtag 0.945748 -50 tcaatgatgaaaagcggtagcacatacaga 3 69 0 aaagcggtag 0.987003 -90 atcaactcctgaagctgaaaccacctttag 3 99 1 gaagctgaaa 0.965477 -60 tcggaatagcaaagcgcaagatcgttagaa 4 81 0 aaagcgcaag 0.980913 -70 gcagcggaaaacagcgcaaagaaaaaagtc 4 109 0 acagcgcaaa 0.96753 -42 aaagacataagcagcggaaaacagcgcaaa 4 119 0 gcagcggaaa 0.985762 -32 cttttaaaataaagcggataattatacatt 5 35 0 aaagcggata 0.978537 -47 aatcgaagcgtttaagtaaggtca 6 52 0 gaagcgttta 0.811136 -14 ********** Masking position 3 Map Score: 9.95097 Number of sites scoring better than the average of aligned sites = 212 Number in coding regions = 188 Number in noncoding regions = 24 Number of orfs with sites within 600 bp upstream = 23 Fraction of orfs with sites within 600 bp upstream = 0.00369419 Motif number 2 ctcaaacttatgtaaaattagagacgtaatt 2 57 1 tgtaaattag 0.763774 -28 aactcctgaagctgaaaccacctttagttcg 3 102 1 gctaaaccac 0.919576 -57 tttaaatcaatgtcaaaccccgaactaaagg 3 122 0 tgtaaacccc 0.968598 -37 ttgacattgatttaaaaaccctcacggacaa 3 137 1 tttaaaaccc 0.825105 -22 agttaggtaaaactacctaacggcaa 5 6 1 ggtaaactac 0.98456 -76 tcaagtctccttttaaaataaagcggataat 5 43 0 tttaaaataa 0.705069 -39 agacttgattggtaaaaataagatta 5 66 1 ggtaaaataa 0.950885 -16 gtgtgaaaatcactgttttaac 6 2 1 tgtaaaatca 0.896309 -64 gttcaaagagggttaaaacagtgattttcac 6 13 0 ggtaaaacag 0.957704 -53 gtttaagtaaggtcaaactacctgttcaaag 6 36 0 ggtaaactac 0.98456 -30 *** ******* Masking position 6 Map Score: 7.67763 Number of sites scoring better than the average of aligned sites = 375 Number in coding regions = 332 Number in noncoding regions = 43 Number of orfs with sites within 600 bp upstream = 32 Fraction of orfs with sites within 600 bp upstream = 0.00513974 Motif number 3 gtgtttgaattacgtctctaatttta 2 69 0 gaattacgtc 0.890564 -16 tttcatcattgaatcaactcctgaagctga 3 87 1 gaatcaactc 0.976114 -72 atcgtctagcgaagcaagtcctcatccaaa 4 27 1 gaagcaagtc 0.988593 -124 acagcgcaaagaaaaaagtcggaatagcaa 4 99 0 gaaaaaagtc 0.95663 -52 ttatttttaccaatcaagtctccttttaaa 5 57 0 caatcaagtc 0.984256 -25 ********** Masking position 6 Map Score: 3.13519 Number of sites scoring better than the average of aligned sites = 17 Number in coding regions = 14 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 4 tgtgcctggctttccttgaggttactaacag 3 35 0 tttccttggg 0.994633 -124 cttgtccgtgagggtttttaaat 3 146 0 tgtccgtggg 0.995391 -13 ttccgacttttttctttgcgctgttttccgc 4 105 1 tttctttggc 0.958955 -46 ccgctgcttatgtctttgtggaccaaatt 4 132 1 tgtctttggg 0.988865 -19 taattatacattgccgttaggtagttttacc 5 16 0 ttgccgttgg 0.945272 -66 ******** ** Masking position 7 Map Score: 2.84878 Number of sites scoring better than the average of aligned sites = 31 Number in coding regions = 26 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 5 gaaactagctttatctatacgt 1 2 1 aaacagcttt 0.97816 -54 acagatgttgtgcctggctttccttgaggtt 3 43 0 tgccggcttt 0.739693 -116 cctgaagctgaaaccacctttagttcggggt 3 106 1 aaacaccttt 0.9769 -53 ttgcttcgctagacgatcttgttggctatcc 4 13 0 agacatcttg 0.945712 -138 agatcgttagaaacagtcttttcgattcaaa 4 62 0 aaacgtcttt 0.963189 -89 agactgtttctaacgatcttgcgctttgcta 4 74 1 taacatcttg 0.950436 -77 atcactgttttaaccctctttgaacaggtag 6 19 1 taacctcttt 0.924539 -47 aagtaaggtcaaactacctgttcaaagaggg 6 32 0 aaacacctgt 0.922854 -34 **** ****** Masking position 9 Map Score: 4.1892 Number of sites scoring better than the average of aligned sites = 164 Number in coding regions = 128 Number in noncoding regions = 36 Number of orfs with sites within 600 bp upstream = 31 Fraction of orfs with sites within 600 bp upstream = 0.00497912 Motif number 6 ********** No masking Map Score: -1.12023e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -1.12023e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -1.12023e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0