AlignACE version 2.2  July 7, 1998
/home/amcguire/bin/alignACE -i221_Ribosomal_Operon_8_mpneu_reg_300.orf -o221_mpneu_300.ace -a/home/amcguire/alignace/lib/ORF_mpneu.txt -z/skink1/amcguire/genomes/mpneu.fna -g0.40 -x5 -e 
Parameter values:
 expect =  	5
 ncols =   	10
 npass =   	1000
 maxnpass =	100
 nruns =   	1000
 maxnruns =	100
 repeat =  	15
 maxreps = 	3
 nread =   	500
 ncycles = 	1
 fragment =	1
 psfact =  	0.1
 gcback =  	0.4
 maxlen =  	30
 weight =  	0.8
 exclude = 	1

Input sequences:
#1	RMP00624	300	Mycoplasma_pneumoniae

Motif number 1

tttttagggaattgtgttggatacagattt	1	20	0	attgtgttgg	    0.839655	-281
taacgattgttttagttttattcaatagtc	1	72	0	tttagtttta	    0.801322	-229
ttattgtggttttaggtgtagatttcgttt	1	99	1	tttaggtgta	    0.942417	-202
taggtgtagatttcgtttggtttttcagtg	1	111	1	tttcgtttgg	    0.979771	-190
tcgtttggtttttcagtggacaaaaattgc	1	123	1	tttcagtgga	    0.908801	-178
ggtgttaatttttcggtgggcaatttttgt	1	142	0	tttcggtggg	    0.994938	-159
cggtttcacaattcggtttgtaacagtagg	1	205	0	attcggtttg	    0.979878	-96
attactaacgattggttgtggtaaaaacac	1	234	0	attggttgtg	    0.940407	-67
          **********

Masking position 7
Map Score:   7.40301

Number of sites scoring better than the average of aligned sites = 321
Number in coding regions = 285
Number in noncoding regions = 36
Number of orfs with sites within 600 bp upstream = 29
Fraction of orfs with sites within 600 bp upstream = 0.00465789


Motif number 2

ctgtatccaacacaattccctaaaaatcct	1	24	1	cacaattccc	    0.981726	-277
aaaccacaataacgattgttttagttttat	1	81	0	aacgattgtt	    0.663283	-220
ttcagtggacaaaaattgcccaccgaaaaa	1	134	1	aaaaattgcc	    0.921902	-167
aattattcttaataattcctcgaacgtcaa	1	172	0	aataattcct	    0.969733	-129
aattattaagaataattcctcctactgtta	1	185	1	aataattcct	    0.969733	-116
aacacggtttcacaattcggtttgtaacag	1	209	0	cacaattcgg	    0.932942	-92
attaattactaacgattggttgtggtaaaa	1	238	0	aacgattggt	     0.94003	-63
          **********

Masking position 5
Map Score:   4.59781

Number of sites scoring better than the average of aligned sites = 166
Number in coding regions = 151
Number in noncoding regions = 15
Number of orfs with sites within 600 bp upstream = 14
Fraction of orfs with sites within 600 bp upstream = 0.00224863


Motif number 3

acaataacgattgttttagttttattcaat	1	76	0	ttgttttagt	    0.927988	-225
atcgttattgtggttttaggtgtagatttc	1	95	1	tggttttagg	    0.982616	-206
agatttcgtttggtttttcagtggacaaaa	1	118	1	tggtttttca	    0.974851	-183
tgtgaaaccgtgtttttaccacaaccaatc	1	225	1	tgtttttacc	    0.940387	-76
atgtaatacgtggtttgtctcgttcaattg	1	269	0	tggtttgtct	    0.968549	-32
          **********

Masking position 5
Map Score:   0.810328

Number of sites scoring better than the average of aligned sites = 277
Number in coding regions = 256
Number in noncoding regions = 21
Number of orfs with sites within 600 bp upstream = 19
Fraction of orfs with sites within 600 bp upstream = 0.00305172


Motif number 4

          **********

No masking
Map Score:   7.91135e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 5

          **********

No masking
Map Score:   7.91135e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 6

          **********

No masking
Map Score:   7.91135e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0