AlignACE version 2.2  July 7, 1998
/home/amcguire/bin/alignACE -i225_Glutamyl_tRNA_synthase_mpneu_reg_100.orf -o225_mpneu_100.ace -a/home/amcguire/alignace/lib/ORF_mpneu.txt -z/skink1/amcguire/genomes/mpneu.fna -g0.40 -x5 -e 
Parameter values:
 expect =  	5
 ncols =   	10
 npass =   	1000
 maxnpass =	100
 nruns =   	1000
 maxnruns =	100
 repeat =  	15
 maxreps = 	3
 nread =   	500
 ncycles = 	1
 fragment =	1
 psfact =  	0.1
 gcback =  	0.4
 maxlen =  	30
 weight =  	0.8
 exclude = 	1

Input sequences:
#1	RMP00596	197	Mycoplasma_pneumoniae

Motif number 1

aaccatttcaaaacagaaattaagttgttt	1	16	1	aaacagaaat	    0.957816	-182
tacgatttcgaaacaaacaacttaatttct	1	30	0	aaacaaacaa	    0.784438	-168
tcgaaatcgtaaaaagtaataaaaagaata	1	49	1	aaaaagtaat	    0.935231	-149
aaaaagtaataaaaagaatactaaaaataa	1	59	1	aaaaagaata	    0.920273	-139
cgagcgacacgaaaagacaaactcatgttc	1	92	0	gaaaagacaa	    0.985771	-106
tcgctcgtcagaaaagaaatgttacatttc	1	115	1	gaaaagaaat	    0.986794	-83
gaaacgtcaagaaatgtaacatttcttttc	1	125	0	gaaatgtaac	    0.905033	-73
caaattcgtcgaaacgtcaagaaatgtaac	1	135	0	gaaacgtcaa	    0.938769	-63
agaaacgttcgaacaaaatctcaacgtttc	1	167	1	gaacaaaatc	    0.800808	-31
    aaacctgaaacgaaacgttgagattt	1	182	0	gaaacgaaac	    0.982876	-16
          **********

Masking position 3
Map Score:   12.1272

Number of sites scoring better than the average of aligned sites = 663
Number in coding regions = 555
Number in noncoding regions = 108
Number of orfs with sites within 600 bp upstream = 77
Fraction of orfs with sites within 600 bp upstream = 0.0123675


Motif number 2

    gacaaaaccatttcaaaacagaaatt	1	7	1	accatttcaa	    0.969195	-191
attactttttacgatttcgaaacaaacaac	1	39	0	acgatttcga	    0.963586	-159
caagaaatgtaacatttcttttctgacgag	1	118	0	aacatttctt	    0.978266	-80
tacatttcttgacgtttcgacgaatttgac	1	137	1	gacgtttcga	    0.988599	-61
attttgttcgaacgtttctgtcaaattcgt	1	156	0	aacgtttctg	    0.984059	-42
acaaaatctcaacgtttcgtttcaggttt 	1	179	1	aacgtttcgt	    0.993962	-19
          **********

Masking position 5
Map Score:   7.91784

Number of sites scoring better than the average of aligned sites = 67
Number in coding regions = 63
Number in noncoding regions = 4
Number of orfs with sites within 600 bp upstream = 3
Fraction of orfs with sites within 600 bp upstream = 0.00048185


Motif number 3

tgttttgaaatggttttgtc          	1	1	0	tggttttgtc	    0.982661	-197
aacttaatttctgttttgaaatggttttgt	1	12	0	ctgttttgaa	    0.897619	-186
ttactttttacgatttcgaaacaaacaact	1	38	0	cgatttcgaa	    0.961532	-160
aaggcgaacatgagtttgtcttttcgtgtc	1	87	1	tgagtttgtc	    0.968548	-111
gacgtttcgacgaatttgacagaaacgttc	1	147	1	cgaatttgac	    0.979086	-51
cgaaacgttgagattttgttcgaacgtttc	1	168	0	agattttgtt	     0.90704	-30
          **********

Masking position 5
Map Score:   2.44494

Number of sites scoring better than the average of aligned sites = 295
Number in coding regions = 256
Number in noncoding regions = 39
Number of orfs with sites within 600 bp upstream = 29
Fraction of orfs with sites within 600 bp upstream = 0.00465789


Motif number 4

          **********

No masking
Map Score:   8.05918e-14

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 5

          **********

No masking
Map Score:   8.05918e-14

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 6

          **********

No masking
Map Score:   8.05918e-14

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0