AlignACE version 2.2  July 7, 1998
/home/amcguire/bin/alignACE -i248_cell_division_mpneu_reg_100.orf -o248_mpneu_100.ace -a/home/amcguire/alignace/lib/ORF_mpneu.txt -z/skink1/amcguire/genomes/mpneu.fna -g0.40 -x5 -e 
Parameter values:
 expect =  	5
 ncols =   	10
 npass =   	1000
 maxnpass =	100
 nruns =   	1000
 maxnruns =	100
 repeat =  	15
 maxreps = 	3
 nread =   	500
 ncycles = 	1
 fragment =	1
 psfact =  	0.1
 gcback =  	0.4
 maxlen =  	30
 weight =  	0.8
 exclude = 	1

Input sequences:
#1	RMP00416	184	Mycoplasma_pneumoniae

Motif number 1

ttgtctttggcaaactagtacttgtaatac	1	69	0	caaactagta	    0.993193	-116
actagttgcaccaaccacttgtctttggca	1	87	0	ccaaccactt	    0.967056	-98
ttagcgcccctcaactagttgcaccaacca	1	100	0	tcaactagtt	    0.990275	-85
ttccttaaagccaactagaataatctagta	1	134	1	ccaactagaa	    0.990092	-51
ccaactagaataatctagtaatgcactatt	1	144	1	taatctagta	    0.951522	-41
          **********

Masking position 7
Map Score:   5.17002

Number of sites scoring better than the average of aligned sites = 105
Number in coding regions = 93
Number in noncoding regions = 12
Number of orfs with sites within 600 bp upstream = 7
Fraction of orfs with sites within 600 bp upstream = 0.00112432


Motif number 2

atacttacttacaatctaactatcatgagcg	1	42	0	acaactaact	    0.974812	-143
ctagtacttgtaatacttacttacaatctaa	1	54	0	taatcttact	    0.963107	-131
tgaggggcgctaaacctttccttaaagccaa	1	117	1	taaactttcc	    0.965741	-68
aacctttccttaaagccaactagaataatct	1	129	1	taaaccaact	    0.982287	-56
gcactattgcaaaatctaacctgatttaa  	1	166	1	aaaactaacc	    0.989333	-19
          **** ******

Masking position 3
Map Score:   2.19836

Number of sites scoring better than the average of aligned sites = 98
Number in coding regions = 84
Number in noncoding regions = 14
Number of orfs with sites within 600 bp upstream = 12
Fraction of orfs with sites within 600 bp upstream = 0.0019274


Motif number 3

          **********

No masking
Map Score:   2.227e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 4

          **********

No masking
Map Score:   2.227e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 5

          **********

No masking
Map Score:   2.227e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0