AlignACE version 2.2  July 7, 1998
/home/amcguire/bin/alignACE -i263_hypothetical_mpneu_reg_100.orf -o263_mpneu_100.ace -a/home/amcguire/alignace/lib/ORF_mpneu.txt -z/skink1/amcguire/genomes/mpneu.fna -g0.40 -x5 -e 
Parameter values:
 expect =  	5
 ncols =   	10
 npass =   	1000
 maxnpass =	100
 nruns =   	1000
 maxnruns =	100
 repeat =  	15
 maxreps = 	3
 nread =   	500
 ncycles = 	1
 fragment =	1
 psfact =  	0.1
 gcback =  	0.4
 maxlen =  	30
 weight =  	0.8
 exclude = 	1

Input sequences:
#1	RMP00501	243	Mycoplasma_pneumoniae

Motif number 1

       ggacctggacagcacaaatggctgt	1	4	1	ctggcagcac	      0.9799	-240
tagaattaaacaatttaagctctttgagaaaa	1	57	1	cattaagctc	    0.991672	-187
tggaggggatcaaatgcaccaccaaagatcac	1	95	0	caatcaccac	    0.973561	-149
gctttaatggcttgtacagcacgcttagcaat	1	143	0	ctgtcagcac	    0.994581	-101
gctgtacaagccattaaagcacaaaagcttta	1	155	1	cattaagcac	    0.996935	-89
cagttggtacaaagtaaagcttttgtgcttta	1	169	0	aagtaagctt	    0.827071	-75
tttaaatcaccgattaaagcatctaatcaagc	1	212	1	cattaagcat	    0.986738	-32
attaaagcatctaatcaagcacgtttagca  	1	224	1	caataagcac	    0.995614	-20
          * *** ******

Masking position 8
Map Score:   12.8429

Number of sites scoring better than the average of aligned sites = 118
Number in coding regions = 106
Number in noncoding regions = 12
Number of orfs with sites within 600 bp upstream = 10
Fraction of orfs with sites within 600 bp upstream = 0.00160617


Motif number 2

ggacctggacagcacaaatggctgtagctatc	1	11	1	acacaaatgc	    0.917849	-233
actattttttttctcaaagagcttaaattgtt	1	65	0	tctcaaaggc	    0.995385	-179
tttgatcccctccaccaagcgcatatctacat	1	113	1	tcaccaaggc	    0.994736	-131
atatctacattgctaagcgtgctgtacaagcc	1	135	1	tctaagcggc	    0.955796	-109
agctttactttgtaccaactgctaaagccttt	1	180	1	ttaccaacgc	    0.936069	-64
taatcggtgatttaaaaaaggctttagcagtt	1	196	0	ttaaaaaagc	    0.876668	-48
          tgctaaacgtgcttgattagat	1	232	0	tctaaacggc	    0.985969	-12
          * ******* **

Masking position 11
Map Score:   3.81166

Number of sites scoring better than the average of aligned sites = 205
Number in coding regions = 186
Number in noncoding regions = 19
Number of orfs with sites within 600 bp upstream = 10
Fraction of orfs with sites within 600 bp upstream = 0.00160617


Motif number 3

cttgtacagcacgcttagcaatgtagatat	1	135	0	acgcttagca	    0.995158	-109
atttaaaaaaggctttagcagttggtacaa	1	189	0	ggctttagca	    0.976086	-55
ctaatcaagcacgtttagca          	1	234	1	acgtttagca	    0.995901	-10
          **********

Masking position 7
Map Score:   1.04691

Number of sites scoring better than the average of aligned sites = 15
Number in coding regions = 13
Number in noncoding regions = 2
Number of orfs with sites within 600 bp upstream = 2
Fraction of orfs with sites within 600 bp upstream = 0.000321234


Motif number 4

agctatcaggattattttagttagaattaaac	1	36	1	attttttatt	     0.96183	-208
aagagcttaaattgtttaattctaactaaaat	1	49	0	atttttaatc	     0.99011	-195
aaagatcactattttttttctcaaagagctta	1	72	0	attttttttc	    0.975384	-172
ctgctaaagccttttttaaatcaccgattaaa	1	198	1	ctttttaatc	    0.983243	-46
          *** ***** **

Masking position 6
Map Score:   0.206375

Number of sites scoring better than the average of aligned sites = 38
Number in coding regions = 29
Number in noncoding regions = 9
Number of orfs with sites within 600 bp upstream = 9
Fraction of orfs with sites within 600 bp upstream = 0.00144555


Motif number 5

          **********

No masking
Map Score:   2.72438e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 6

          **********

No masking
Map Score:   2.72438e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 7

          **********

No masking
Map Score:   2.72438e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0