AlignACE version 2.2  July 7, 1998
/home/amcguire/bin/alignACE -i263_hypothetical_mpneu_reg_300.orf -o263_mpneu_300.ace -a/home/amcguire/alignace/lib/ORF_mpneu.txt -z/skink1/amcguire/genomes/mpneu.fna -g0.40 -x5 -e 
Parameter values:
 expect =  	5
 ncols =   	10
 npass =   	1000
 maxnpass =	100
 nruns =   	1000
 maxnruns =	100
 repeat =  	15
 maxreps = 	3
 nread =   	500
 ncycles = 	1
 fragment =	1
 psfact =  	0.1
 gcback =  	0.4
 maxlen =  	30
 weight =  	0.8
 exclude = 	1

Input sequences:
#1	RMP00501	243	Mycoplasma_pneumoniae

Motif number 1

acagccatttgtgctgtccaggtcc       	1	4	0	gtgctgccag	    0.979134	-240
ttttctcaaagagcttaaattgtttaattcta	1	57	0	gagcttaatg	    0.991351	-187
gtgatctttggtggtgcatttgatcccctcca	1	95	1	gtggtgattg	     0.97256	-149
attgctaagcgtgctgtacaagccattaaagc	1	143	1	gtgctgacag	    0.994371	-101
taaagcttttgtgctttaatggcttgtacagc	1	155	0	gtgcttaatg	    0.996816	-89
taaagcacaaaagctttactttgtaccaactg	1	169	1	aagcttactt	    0.821543	-75
gcttgattagatgctttaatcggtgatttaaa	1	212	0	atgcttaatg	    0.986229	-32
  tgctaaacgtgcttgattagatgctttaat	1	224	0	gtgcttattg	    0.995445	-20
          ****** *** *

Masking position 5
Map Score:   12.8429

Number of sites scoring better than the average of aligned sites = 118
Number in coding regions = 106
Number in noncoding regions = 12
Number of orfs with sites within 600 bp upstream = 10
Fraction of orfs with sites within 600 bp upstream = 0.00160617


Motif number 2

gatagctacagccatttgtgctgtccaggtcc	1	11	0	gcatttgtgt	    0.922026	-233
aacaatttaagctctttgagaaaaaaaatagt	1	65	1	gcctttgaga	    0.995638	-179
atgtagatatgcgcttggtggaggggatcaaa	1	113	0	gccttggtga	    0.995025	-131
ggcttgtacagcacgcttagcaatgtagatat	1	135	0	gccgcttaga	    0.958132	-109
aaaggctttagcagttggtacaaagtaaagct	1	180	0	gcgttggtaa	    0.939381	-64
aactgctaaagccttttttaaatcaccgatta	1	196	1	gcttttttaa	    0.882671	-48
atctaatcaagcacgtttagca          	1	232	1	gccgtttaga	    0.986733	-12
          ** ******* *

Masking position 2
Map Score:   3.81166

Number of sites scoring better than the average of aligned sites = 205
Number in coding regions = 186
Number in noncoding regions = 19
Number of orfs with sites within 600 bp upstream = 10
Fraction of orfs with sites within 600 bp upstream = 0.00160617


Motif number 3

cttgtacagcacgcttagcaatgtagatat	1	135	0	acgcttagca	    0.995158	-109
atttaaaaaaggctttagcagttggtacaa	1	189	0	ggctttagca	    0.976086	-55
ctaatcaagcacgtttagca          	1	234	1	acgtttagca	    0.995901	-10
          **********

Masking position 7
Map Score:   1.04691

Number of sites scoring better than the average of aligned sites = 15
Number in coding regions = 13
Number in noncoding regions = 2
Number of orfs with sites within 600 bp upstream = 2
Fraction of orfs with sites within 600 bp upstream = 0.000321234


Motif number 4

gtttaattctaactaaaataatcctgatagct	1	36	0	aataaaaaat	    0.960234	-208
attttagttagaattaaacaatttaagctctt	1	49	1	gattaaaaat	    0.989684	-195
taagctctttgagaaaaaaaatagtgatcttt	1	72	1	gaaaaaaaat	     0.97434	-172
tttaatcggtgatttaaaaaaggctttagcag	1	198	0	gattaaaaag	    0.982527	-46
          ** ***** ***

Masking position 6
Map Score:   0.206375

Number of sites scoring better than the average of aligned sites = 38
Number in coding regions = 29
Number in noncoding regions = 9
Number of orfs with sites within 600 bp upstream = 9
Fraction of orfs with sites within 600 bp upstream = 0.00144555


Motif number 5

          **********

No masking
Map Score:   2.72438e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 6

          **********

No masking
Map Score:   2.72438e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 7

          **********

No masking
Map Score:   2.72438e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0