AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i293_mixed_mpneu_reg_300.orf -o293_mpneu_300.ace -a/home/amcguire/alignace/lib/ORF_mpneu.txt -z/skink1/amcguire/genomes/mpneu.fna -g0.40 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.4 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMP00131 20 Mycoplasma_pneumoniae #2 RMP00134 45 Mycoplasma_pneumoniae #3 RMP00137 300 Mycoplasma_pneumoniae #4 RMP00170 170 Mycoplasma_pneumoniae #5 RMP00172 180 Mycoplasma_pneumoniae #6 RMP00613 55 Mycoplasma_pneumoniae #7 RMP00617 275 Mycoplasma_pneumoniae Motif number 1 attaatataattaaatcggtttcgatcaaaaa 3 247 1 ttaacggttt 0.847495 -54 tgccttcattttaatttggtttaagccaccaa 4 29 1 ttattggttt 0.945365 -142 ttagaattttatgcgatggtttagtgtgttgg 5 21 1 atggtggttt 0.913172 -160 cgatggtttagtgtgttggtttccctggtaaa 5 34 1 gtggtggttt 0.966314 -147 gatgatttttttgtgcttttttaccagggaaa 5 53 0 ttggtttttt 0.739972 -128 agaaaggtaattaagatgatttttttgtgctt 5 67 0 ttagtgattt 0.961951 -114 cctttctaactttggctggttttgcagcagtg 5 92 1 tttgtggttt 0.961195 -89 tgttgggtgatttgactggtttttattctaac 5 148 0 tttatggttt 0.79236 -33 ttgttgttgtttgttgggtgat 5 169 0 ttgtttgttt 0.784202 -12 aaccacaccattattgcgatttgatcgagggt 6 32 0 ttatcgattt 0.719758 -24 accaagttttgtaagatgtttttttgctatga 7 20 0 gtagtgtttt 0.810639 -256 actacattggtcaggttgattttcacgtctac 7 128 0 tcagtgattt 0.786689 -148 ttgtgaaagcttatgattattttttctttttc 7 214 0 ttagttattt 0.820903 -62 gcgattgtgacggtttgggtttgcaa 7 260 0 ttggcggttt 0.976627 -16 *** * ****** Masking position 10 Map Score: 10.5785 Number of sites scoring better than the average of aligned sites = 395 Number in coding regions = 343 Number in noncoding regions = 52 Number of orfs with sites within 600 bp upstream = 38 Fraction of orfs with sites within 600 bp upstream = 0.00610344 Motif number 2 ttcccagagtttgggagttggaggactcacg 3 71 1 ttggagttgg 0.958648 -230 ttacctgaacttggtagctggagtgggaata 3 152 1 ttggagctgg 0.983418 -149 ggtagctggagtgggaatagtccccacacga 3 164 1 gtggaatagt 0.947387 -137 caaatctcaattgggaacagtaaatgattgg 4 57 0 ttggaacagt 0.98241 -114 aagacaaagcttggcagcaggttttatttag 4 90 0 ttggagcagg 0.986499 -81 ggaaaagggggtggcaaaagtataattaaca 4 141 1 gtggaaaagt 0.876947 -30 cgtggtatctgttaattatact 4 159 0 gtggatctgt 0.919125 -12 tttggctggttttgcagcagtgggtgtatta 5 102 1 tttgagcagt 0.89674 -79 cttacaaaacttggtgattgttacaaaaatc 7 37 1 ttgggattgt 0.805449 -239 **** ****** Masking position 2 Map Score: 7.05079 Number of sites scoring better than the average of aligned sites = 177 Number in coding regions = 143 Number in noncoding regions = 34 Number of orfs with sites within 600 bp upstream = 24 Fraction of orfs with sites within 600 bp upstream = 0.0038548 Motif number 3 atttaagattagattaaatt 1 3 0 ttagattaaa 0.954768 -18 gcggattgaattagaatatactgatcaatc 3 14 1 ttagaatata 0.807449 -287 ttaaatcggtttcgatcaaaaattcgccag 3 257 1 ttcgatcaaa 0.902068 -44 caggttttatttagatcaaatctcaattgg 4 74 0 ttagatcaaa 0.896512 -97 cttagtgttgttagaataaaaaccagtcaa 5 139 1 ttagaataaa 0.905936 -42 gtttaacaccctcgatcaaatcgcaataat 6 25 1 ctcgatcaaa 0.905501 -31 cagggagtcgtacgattataagaccaatgg 7 169 0 tacgattata 0.7072 -107 ********** Masking position 5 Map Score: 4.09332 Number of sites scoring better than the average of aligned sites = 45 Number in coding regions = 38 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 4 taatttctaggtttgcagattgatcagtata 3 30 0 gtttgagatt 0.871329 -271 gagtttgggagttggaggactcacgtttagt 3 77 1 gttggggact 0.988841 -224 aaccaatctcgtgtggggactattcccactc 3 172 0 gtgtgggact 0.971389 -129 cccacacgagattggttgactcgatatgaag 3 186 1 attggtgact 0.907523 -115 acagtaaatgattggtggcttaaaccaaatt 4 41 0 attggggctt 0.864179 -130 cgatggtttagtgtgttggtttccctggtaa 5 34 1 gtgtgtggtt 0.837674 -147 ttttgcagcagtgggtgtattagttaccctt 5 111 1 gtggggtatt 0.908219 -70 gttgttgtttgttgggtgatttgactggttt 5 158 0 gttggtgatt 0.977665 -23 ***** ***** Masking position 2 Map Score: 2.4817 Number of sites scoring better than the average of aligned sites = 113 Number in coding regions = 104 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 5 aagtagaggtggtaatttctaggtttgcagat 3 41 0 ggttttctag 0.945395 -260 ggtaaatgaaggtggttattacccctacatcg 3 125 0 ggtttattac 0.904041 -176 tcgatatgaaggtccgttttagaagcatgtcc 3 206 1 ggtgttttag 0.945395 -95 cttggcagcaggttttatttagatcaaatctc 4 80 0 ggttatttag 0.974919 -91 tgccaagctttgtcttttttagctctcaacat 4 105 1 tgttttttag 0.960452 -66 cagcagtgggtgtattagttacccttagtgtt 5 116 1 tgttagttac 0.865504 -65 ttgttgttgtttgttgggtgatt 5 168 0 tgtttgtttg 0.789588 -13 tacaaaacttggtgattgttacaaaaatcgct 7 39 1 ggtttgttac 0.973979 -237 ctcacctttggctaatatttagcgcaaaggga 7 91 1 gcttatttag 0.849577 -185 *** ******* Masking position 3 Map Score: 2.65708 Number of sites scoring better than the average of aligned sites = 133 Number in coding regions = 112 Number in noncoding regions = 21 Number of orfs with sites within 600 bp upstream = 16 Fraction of orfs with sites within 600 bp upstream = 0.00256987 Motif number 6 atttaagattagattaaatt 1 11 0 atttaagatt 0.937448 -10 gtaagctcacaattaatattttgacgaaac 2 13 0 aattaatatt 0.913425 -33 tgatgaacgaaattaatattctggcgaatt 3 277 0 aattaatatt 0.913425 -24 gcttaaaccaaattaaaatgaaggcaagct 4 25 0 aattaaaatg 0.890065 -146 tactgttcccaattgagatttgatctaaat 4 66 1 aattgagatt 0.863789 -105 gtcgcgctatttagaattttatgcgatg 5 9 1 atttagaatt 0.71622 -172 ttagaaaggtaattaagatgatttttttgt 5 71 0 aattaagatg 0.931359 -110 gttaaacgatctttaaaattt 6 2 0 ctttaaaatt 0.716538 -54 ********** Masking position 8 Map Score: 3.1702 Number of sites scoring better than the average of aligned sites = 48 Number in coding regions = 31 Number in noncoding regions = 17 Number of orfs with sites within 600 bp upstream = 15 Fraction of orfs with sites within 600 bp upstream = 0.00240925 Motif number 7 gagttgactatctcgtggactaaacgtgag 3 96 0 tctcgtggac 0.966112 -205 tacccctacatcgagttgactatctcgtgg 3 108 0 tcgagttgac 0.8844 -193 tattaatacttcgcttggacatgcttctaa 3 224 0 tcgcttggac 0.989451 -77 ctttctaaactacattggtcaggttgattt 7 138 0 tacattggtc 0.899222 -138 gtttagaaagtccattggtcttataatcgt 7 158 1 tccattggtc 0.978977 -118 ttttttctttttccttggaccaagagtcca 7 197 0 ttccttggac 0.963075 -79 ********** Masking position 6 Map Score: 1.39012 Number of sites scoring better than the average of aligned sites = 29 Number in coding regions = 27 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 aatagtgaaattagtaagctcacaatta 2 28 0 aattagtaag 0.92228 -18 aaaccagccaaagttagaaaggtaattaaga 5 83 0 agttagaaag 0.928507 -98 aaattttaaagatcgtttaac 6 1 1 aattttaaag 0.722975 -55 acaatcaccaagttttgtaagatgttttttt 7 27 0 attttgtaag 0.966477 -249 aaaatcagcgatttttgtaacaatcaccaag 7 46 0 attttgtaac 0.847151 -230 tgaccaatgtagtttagaaagtccattggtc 7 147 1 atttagaaag 0.966474 -129 tcttatatgaacttgtgaaagcttatgatta 7 227 0 attgtgaaag 0.920323 -49 * ********* Masking position 9 Map Score: 0.794667 Number of sites scoring better than the average of aligned sites = 108 Number in coding regions = 84 Number in noncoding regions = 24 Number of orfs with sites within 600 bp upstream = 23 Fraction of orfs with sites within 600 bp upstream = 0.00369419 Motif number 9 actctgggaagtagaggtggtaatttctag 3 51 0 gtagaggtgg 0.956286 -250 atctcgtggactaaacgtgagtcctccaac 3 87 0 ctaaacgtga 0.952115 -214 tcaactcgatgtaggggtaataaccacctt 3 119 1 gtaggggtaa 0.943692 -182 tctaacaacactaagggtaactaatacacc 5 124 0 ctaagggtaa 0.914203 -57 taaatattagccaaaggtgagcctcagttt 7 82 0 ccaaaggtga 0.932942 -194 agggacatcggtagacgtgaaaatcaacct 7 118 1 gtagacgtga 0.969012 -158 ********** Masking position 3 Map Score: 0.157049 Number of sites scoring better than the average of aligned sites = 49 Number in coding regions = 46 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 10 ********** No masking Map Score: -9.4259e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 11 ********** No masking Map Score: -9.4259e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 12 ********** No masking Map Score: -9.4259e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0