AlignACE version 2.2  July 7, 1998
/home/amcguire/bin/alignACE -i299_mixed14_mpneu_reg_100.orf -o299_mpneu_100.ace -a/home/amcguire/alignace/lib/ORF_mpneu.txt -z/skink1/amcguire/genomes/mpneu.fna -g0.40 -x5 -e 
Parameter values:
 expect =  	5
 ncols =   	10
 npass =   	1000
 maxnpass =	100
 nruns =   	1000
 maxnruns =	100
 repeat =  	15
 maxreps = 	3
 nread =   	500
 ncycles = 	1
 fragment =	1
 psfact =  	0.1
 gcback =  	0.4
 maxlen =  	30
 weight =  	0.8
 exclude = 	1

Input sequences:
#1	RMP00504	194	Mycoplasma_pneumoniae

Motif number 1

actagaatccgtggaacttcaggacttaac	1	18	0	gtggaacttc	     0.99512	-177
tactggtaaaatgggaatttttcccattaa	1	51	0	atgggaattt	    0.835896	-144
aagatcgattgtgaatattctttacttaat	1	89	0	gtgaatattc	    0.938882	-106
aatattcacaatcgatcttctcctgctgcc	1	100	1	atcgatcttc	    0.948517	-95
aataaaacgaatggaacgtgtcgtttgtga	1	153	1	atggaacgtg	    0.965123	-42
cgtgtcgtttgtgaggcgtcgttttggacg	1	169	1	gtgaggcgtc	    0.979661	-26
          gtgggtcgtccaaaacgacg	1	185	0	gtgggtcgtc	     0.99621	-10
          **********

Masking position 2
Map Score:   6.81685

Number of sites scoring better than the average of aligned sites = 188
Number in coding regions = 169
Number in noncoding regions = 19
Number of orfs with sites within 600 bp upstream = 18
Fraction of orfs with sites within 600 bp upstream = 0.0028911


Motif number 2

tgtcgtgagaaaacggcagcaggagaagat	1	114	0	aaacggcagc	    0.993271	-81
tgccgttttctcacgacatcctgaatgaat	1	126	1	tcacgacatc	    0.942687	-69
tgaatgaataaaacgaatggaacgtgtcgt	1	147	1	aaacgaatgg	    0.944627	-48
gacgcctcacaaacgacacgttccattcgt	1	159	0	aaacgacacg	    0.995574	-36
gggtcgtccaaaacgacgcctcacaaacga	1	173	0	aaacgacgcc	    0.994824	-22
          **********

Masking position 3
Map Score:   3.52293

Number of sites scoring better than the average of aligned sites = 48
Number in coding regions = 47
Number in noncoding regions = 1
Number of orfs with sites within 600 bp upstream = 1
Fraction of orfs with sites within 600 bp upstream = 0.000160617


Motif number 3

aacttcaggacttaaccattttt       	1	4	0	cttaaccatt	    0.984449	-191
aaatgggaatttttcccattaatagactag	1	43	0	ttttcccatt	    0.989097	-152
aaaattcccattttaccagtagtaatttga	1	60	1	ttttaccagt	    0.984449	-135
ttccattcgttttattcattcaggatgtcg	1	139	0	tttattcatt	    0.939043	-56
          **********

Masking position 3
Map Score:   1.86314

Number of sites scoring better than the average of aligned sites = 124
Number in coding regions = 109
Number in noncoding regions = 15
Number of orfs with sites within 600 bp upstream = 14
Fraction of orfs with sites within 600 bp upstream = 0.00224863


Motif number 4

          **********

No masking
Map Score:   3.15071e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 5

          **********

No masking
Map Score:   3.15071e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 6

          **********

No masking
Map Score:   3.15071e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0