AlignACE version 2.2  July 7, 1998
/home/amcguire/bin/alignACE -i301_mixed16_mpneu_reg_300.orf -o301_mpneu_300.ace -a/home/amcguire/alignace/lib/ORF_mpneu.txt -z/skink1/amcguire/genomes/mpneu.fna -g0.40 -x5 -e 
Parameter values:
 expect =  	5
 ncols =   	10
 npass =   	1000
 maxnpass =	100
 nruns =   	1000
 maxnruns =	100
 repeat =  	15
 maxreps = 	3
 nread =   	500
 ncycles = 	1
 fragment =	1
 psfact =  	0.1
 gcback =  	0.4
 maxlen =  	30
 weight =  	0.8
 exclude = 	1

Purged sequences:
RMP00371	18	Mycoplasma_pneumoniae

Input sequences:
#1	RMP00126	20	Mycoplasma_pneumoniae
#2	RMP00127	32	Mycoplasma_pneumoniae
#3	RMP00368	300	Mycoplasma_pneumoniae

Motif number 1

gattttgacgaaaacttaaacgaacaaagtttgct	3	21	1	aaattacaac	    0.957394	-280
ttaaacgaacaaagtttgctcaagcaactcatgcc	3	36	1	aaattccagc	    0.989722	-265
ttgctcaagcaactcatgcccaaaacccgtaacat	3	51	1	aacatccaaa	    0.985701	-250
ccaaaacccgtaacattaccctagaaccaacaagg	3	70	1	taattccaga	    0.915823	-231
gggaaacaataacagttcccctagaacgtaacatt	3	103	1	aacttccaga	    0.993603	-198
tctctaactgatctaattcgccaaagaaactacgt	3	143	0	atcatccaaa	    0.925112	-158
tgatgtgttaaaccacttcgctaaccaactccaag	3	247	1	aacctccaac	    0.989236	-54
ataaaccgcaaaccgttgatctaaca         	3	285	1	aacttacaac	    0.982901	-16
          ***  ** * * ***

Masking position 13
Map Score:   6.70815

Number of sites scoring better than the average of aligned sites = 192
Number in coding regions = 171
Number in noncoding regions = 21
Number of orfs with sites within 600 bp upstream = 16
Fraction of orfs with sites within 600 bp upstream = 0.00256987


Motif number 2

         tacgaaatagatagaattag  	1	9	0	acgaatagat	    0.979415	-12
gaaaacttaaacgaacaaagtttgctcaagc	3	30	1	acgaaaaagt	    0.904984	-271
agtttctttggcgaattagatcagttagaga	3	147	1	gcgaatagat	    0.992956	-154
gaaaaaaattgcgaattgattgttctttctc	3	174	0	gcgaatgatt	    0.981089	-127
ctaccataaagtgaaaaaaattgcgaattga	3	186	0	gtgaaaaaat	    0.881443	-115
gagttggttagcgaagtggtttaacacatca	3	247	0	gcgaatggtt	     0.98789	-54
          ***** *****

Masking position 5
Map Score:   4.00184

Number of sites scoring better than the average of aligned sites = 69
Number in coding regions = 58
Number in noncoding regions = 11
Number of orfs with sites within 600 bp upstream = 8
Fraction of orfs with sites within 600 bp upstream = 0.00128493


Motif number 3

         ctaattctatctatttcgta 	1	2	1	taattctatc	    0.836183	-19
tgagcaaactttgttcgtttaagttttcgt	3	28	0	ttgttcgttt	     0.96262	-273
attgtttcccttgttggttctagggtaatg	3	83	0	ttgttggttc	    0.989277	-218
aggggaactgttattgtttcccttgttggt	3	95	0	ttattgtttc	    0.974314	-206
tgcgaattgattgttctttctctaactgat	3	166	0	ttgttctttc	    0.992031	-135
          **********

Masking position 5
Map Score:   3.63241

Number of sites scoring better than the average of aligned sites = 50
Number in coding regions = 42
Number in noncoding regions = 8
Number of orfs with sites within 600 bp upstream = 5
Fraction of orfs with sites within 600 bp upstream = 0.000803084


Motif number 4

tggcttttgaccacaccatatctaccataaa	3	207	0	ccacccatat	    0.992764	-94
ggtcaaaagccaaccccatgttgatgtgtta	3	226	1	caacccatgt	    0.997758	-75
cttcgctaaccaactccaagttcataaaccg	3	262	1	caacccaagt	    0.996058	-39
          **** ******

Masking position 8
Map Score:   1.13593

Number of sites scoring better than the average of aligned sites = 11
Number in coding regions = 9
Number in noncoding regions = 2
Number of orfs with sites within 600 bp upstream = 1
Fraction of orfs with sites within 600 bp upstream = 0.000160617


Motif number 5

          aagttttcagaaaatattag	2	1	1	aagttttcag	    0.945248	-32
ttgttcgtttaagttttcgtcaaaatcgtg	3	18	0	aagttttcgt	    0.977821	-283
gttctagggtaatgttacgggttttgggca	3	67	0	aatgttacgg	    0.985632	-234
tacgttctacaatgttacgttctaggggaa	3	118	0	aatgttacgt	    0.977944	-183
          **********

Masking position 5
Map Score:   1.01432

Number of sites scoring better than the average of aligned sites = 32
Number in coding regions = 22
Number in noncoding regions = 10
Number of orfs with sites within 600 bp upstream = 7
Fraction of orfs with sites within 600 bp upstream = 0.00112432


Motif number 6

          **********

No masking
Map Score:   -6.15168e-14

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 7

          **********

No masking
Map Score:   -6.15168e-14

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 8

          **********

No masking
Map Score:   -6.15168e-14

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0