AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i038_Galactose_Metabolism__mtub_reg_100.orf -a/home/amcguire/alignace/lib/ORF_mtub.txt -z/skink1/amcguire/genomes/mtub.fna -g0.66 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.66 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 galT' 128 galT' Motif number 1 GCGCCGCCGGGAGACGATGCACA 1 4 0 GAGACGATGC 0.980284 -125 GCGGCTCGCCGCGCCGCCGGGAGACGATGC 1 14 0 GCGCCGCCGG 0.844763 -115 GCGGCGCGGCGAGCCGCCCCAAAACCAACG 1 27 1 GAGCCGCCCC 0.888028 -102 CAACGATTGGGCCACGATGCGTAGGCATAG 1 52 1 GCCACGATGC 0.980129 -77 GGTGAGGGCCGCGACGCCACCTCAGCTATG 1 77 0 GCGACGCCAC 0.782997 -52 GCCCTCACCGGCGACACCACAGAGGATCTC 1 98 1 GCGACACCAC 0.983496 -31 AGAGGATCTCGGGCCGATCCG 1 118 1 GGGCCGATCC 0.947624 -11 ********** Masking position 5 Map Score: 18.6523 Number of sites scoring better than the average of aligned sites = 9801 Number in coding regions = 8999 Number in noncoding regions = 802 Number of orfs with sites within 600 bp upstream = 519 Fraction of orfs with sites within 600 bp upstream = 0.0833601 Motif number 2 CGCGCCGCCGGGAGACGATGCACA 1 4 0 GGAGCGATGC 0.95092 -125 ATCGTCTCCCGGCGGCGCGGCGAGCCGCCCC 1 16 1 GGCGCGCGGC 0.687834 -113 CCCAATCGTTGGTTTTGGGGCGGCTCGCCGC 1 32 0 GGTTTGGGGC 0.9928 -97 CCCCAAAACCAACGATTGGGCCACGATGCGT 1 43 1 AACGTTGGGC 0.907164 -86 ATTGGGCCACGATGCGTAGGCATAGCTGAGG 1 57 1 GATGGTAGGC 0.947115 -72 CGTAGGCATAGCTGAGGTGGCGTCGCGGCCC 1 71 1 GCTGGGTGGC 0.953724 -58 CTGTGGTGTCGCCGGTGAGGGCCGCGACGCC 1 89 0 GCCGTGAGGG 0.96376 -40 ACACCACAGAGGATCTCGGGCCGATCCG 1 111 1 GGATTCGGGC 0.955011 -18 **** ****** Masking position 10 Map Score: 6.42523 Number of sites scoring better than the average of aligned sites = 24477 Number in coding regions = 22660 Number in noncoding regions = 1817 Number of orfs with sites within 600 bp upstream = 1006 Fraction of orfs with sites within 600 bp upstream = 0.16158 Motif number 3 ********** No masking Map Score: -1.89414e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -1.89414e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.89414e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0