AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i107_TRK_operon_mtub_reg_100.orf -a/home/amcguire/alignace/lib/ORF_mtub.txt -z/skink1/amcguire/genomes/mtub.fna -g0.66 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.66 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 trkA 134 trkA Motif number 1 CTCGGATAGGCCTACCCTTGGCTCTC 1 7 0 CCTACCCTTG 0.951744 -128 CAAGGGTAGGCCTATCCGAGCGTGGCGGTA 1 17 1 CCTATCCGAG 0.996747 -118 GGTAGCGTTCCCTAGACGAGAATGTTCGCC 1 43 1 CCTAGACGAG 0.994718 -92 ACCCGCGGTGGCCAGCCGATTTACGTCGGC 1 70 0 GCCAGCCGAT 0.991216 -65 TACGCGATCGGCAACCCGCGGTGGCCAGCC 1 83 0 GCAACCCGCG 0.992062 -52 TGTCCGGTGCGCCGTACGCGATCGGCAACC 1 97 0 GCCGTACGCG 0.961456 -38 GCGCACCGGACACAGCCGAGAGGACCTCTA 1 115 1 CACAGCCGAG 0.919771 -20 ********** Masking position 7 Map Score: 11.2449 Number of sites scoring better than the average of aligned sites = 8086 Number in coding regions = 7470 Number in noncoding regions = 616 Number of orfs with sites within 600 bp upstream = 502 Fraction of orfs with sites within 600 bp upstream = 0.0806296 Motif number 2 TATCCGAGCGTGGCGGTAGCGTTCCCTAGA 1 29 1 TGGCGGTAGC 0.992648 -106 TAGACGAGAATGTTCGCCGACGTAAATCGG 1 55 1 TGTTCGCCGA 0.966101 -80 GTAAATCGGCTGGCCACCGCGGGTTGCCGA 1 76 1 TGGCCACCGC 0.998117 -59 CACCGCGGGTTGCCGATCGCGTACGGCGCA 1 90 1 TGCCGATCGC 0.992348 -45 CTCTCGGCTGTGTCCGGTGCGCCGTACGCG 1 107 0 TGTCCGGTGC 0.990538 -28 ********** Masking position 1 Map Score: 4.68093 Number of sites scoring better than the average of aligned sites = 11075 Number in coding regions = 10446 Number in noncoding regions = 629 Number of orfs with sites within 600 bp upstream = 470 Fraction of orfs with sites within 600 bp upstream = 0.0754899 Motif number 3 AGACGAGAATGTTCGCCGACGTAAATCGGC 1 56 1 GTTCGCCGAC 0.973965 -79 GGCCACCGCGGGTTGCCGATCGCGTACGGC 1 87 1 GGTTGCCGAT 0.992135 -48 GCTGTGTCCGGTGCGCCGTACGCGATCGGC 1 101 0 GTGCGCCGTA 0.994829 -34 ********** Masking position 5 Map Score: 1.67287 Number of sites scoring better than the average of aligned sites = 1395 Number in coding regions = 1325 Number in noncoding regions = 70 Number of orfs with sites within 600 bp upstream = 64 Fraction of orfs with sites within 600 bp upstream = 0.0102795 Motif number 4 ********** No masking Map Score: 1.09013e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.09013e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 1.09013e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0