AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i122_Arsenical_Resistance_Pump_mtub_reg_100.orf -a/home/amcguire/alignace/lib/ORF_mtub.txt -z/skink1/amcguire/genomes/mtub.fna -g0.66 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.66 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 Rv2642 135 hypothetical protein Rv2642 Motif number 1 GCTTGGAGACGCACCCCGGGGTCAGGCCTA 1 14 0 GCACCCCGGG 0.999629 -122 CCCGGGGTGGGCTCCGCGGCTTGGAGACGC 1 32 0 GCTCCGCGGC 0.98927 -104 GCCGCGGAGCCCACCCCGGGCCACTCAATG 1 42 1 CCACCCCGGG 0.998891 -94 GGTGAACGGCGCTACGCGGGTTAGGGGGCA 1 70 0 GCTACGCGGG 0.995061 -66 GTAGCGCCGTTCACCGCGTGGCCGCTTGCG 1 85 1 TCACCGCGTG 0.996682 -51 ********** Masking position 5 Map Score: 16.2939 Number of sites scoring better than the average of aligned sites = 964 Number in coding regions = 888 Number in noncoding regions = 76 Number of orfs with sites within 600 bp upstream = 83 Fraction of orfs with sites within 600 bp upstream = 0.0133312 Motif number 2 CTGTAGGCCTGACCCCGGGGTGCGTC 1 7 1 GCCTGACCCC 0.998927 -129 GCGGCTTGGAGACGCACCCCGGGGTCAGGC 1 17 0 GACGCACCCC 0.980612 -119 GGGGTGCGTCTCCAAGCCGCGGAGCCCACC 1 27 1 TCCAAGCCGC 0.952915 -109 AGGGGGCATTGAGTGGCCCGGGGTGGGCTC 1 48 0 GAGTGGCCCG 0.992706 -88 ACTCAATGCCCCCTAACCCGCGTAGCGCCG 1 64 1 CCCTAACCCG 0.98437 -72 GCCGTTCACCGCGTGGCCGCTTGCGGACCT 1 90 1 GCGTGGCCGC 0.89708 -46 ********** Masking position 7 Map Score: 7.16945 Number of sites scoring better than the average of aligned sites = 7698 Number in coding regions = 7023 Number in noncoding regions = 675 Number of orfs with sites within 600 bp upstream = 527 Fraction of orfs with sites within 600 bp upstream = 0.084645 Motif number 3 ********** No masking Map Score: -1.11255e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -1.11255e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.11255e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0