AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i136_Transmembrane_Transport_10_mtub_reg_100.orf -a/home/amcguire/alignace/lib/ORF_mtub.txt -z/skink1/amcguire/genomes/mtub.fna -g0.66 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.66 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 Rv1273c 146 hypothetical protein Rv1273c Motif number 1 GCTGTGATCGGCAGTGGGAGAGGTAGCG 1 9 0 GCAGTGGGAG 0.953628 -138 CGGCTACAGTGCATGCTGTGATCGGCAGTG 1 23 0 GCATGCTGTG 0.993452 -124 TGACCCGCGGGCCTGCGGCTACAGTGCATG 1 38 0 GCCTGCGGCT 0.980484 -109 TGGTTAACTGGCGTGTCGTGGTTGACCCGC 1 60 0 GCGTGTCGTG 0.974827 -87 AGTTAACCAGGCATTTCGGCCTAAGACTCA 1 81 1 GCATTTCGGC 0.936146 -66 TAAGACTCATGCCTGGCGCGGGTAGGCAGC 1 102 1 GCCTGGCGCG 0.997862 -45 CGCACACTGCGCATGCTGCCTACCCGCGCC 1 116 0 GCATGCTGCC 0.994662 -31 GGCAGCATGCGCAGTGTGCGACAGTTACCC 1 126 1 GCAGTGTGCG 0.990041 -21 ********** Masking position 8 Map Score: 11.4672 Number of sites scoring better than the average of aligned sites = 12164 Number in coding regions = 11251 Number in noncoding regions = 913 Number of orfs with sites within 600 bp upstream = 652 Fraction of orfs with sites within 600 bp upstream = 0.104722 Motif number 2 CTGCGGCTACAGTGCATGCTGTGATCGGCA 1 26 0 AGTGCATGCT 0.979787 -121 GGTTGACCCGCGGGCCTGCGGCTACAGTGC 1 41 0 CGGGCCTGCG 0.988485 -106 TCAACCACGACACGCCAGTTAACCAGGCAT 1 65 1 CACGCCAGTT 0.983265 -82 CTTAGGCCGAAATGCCTGGTTAACTGGCGT 1 76 0 AATGCCTGGT 0.983361 -71 GCCTAAGACTCATGCCTGGCGCGGGTAGGC 1 99 1 CATGCCTGGC 0.979875 -48 TGTCGCACACTGCGCATGCTGCCTACCCGC 1 119 0 TGCGCATGCT 0.98703 -28 ATGCGCAGTGTGCGACAGTTACCCA 1 132 1 TGCGACAGTT 0.875017 -15 ********** Masking position 4 Map Score: 6.26958 Number of sites scoring better than the average of aligned sites = 9102 Number in coding regions = 8393 Number in noncoding regions = 709 Number of orfs with sites within 600 bp upstream = 573 Fraction of orfs with sites within 600 bp upstream = 0.0920334 Motif number 3 GCAGGCCCGCGGGTCAACCACGACACGCCA 1 52 1 GGGTCAACCA 0.892141 -95 CACGACACGCCAGTTAACCAGGCATTTCGG 1 70 1 CAGTTAACCA 0.930038 -77 ATGCCTGGCGCGGGTAGGCAGCATGCGCAG 1 110 1 CGGGTAGGCA 0.980509 -37 CAGTGTGCGACAGTTACCCA 1 137 1 CAGTTACCCA 0.954384 -10 ********** Masking position 6 Map Score: 3.27002 Number of sites scoring better than the average of aligned sites = 446 Number in coding regions = 403 Number in noncoding regions = 43 Number of orfs with sites within 600 bp upstream = 40 Fraction of orfs with sites within 600 bp upstream = 0.00642467 Motif number 4 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0