AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i184_thi_operon_mtub_reg_100.orf -a/home/amcguire/alignace/lib/ORF_mtub.txt -z/skink1/amcguire/genomes/mtub.fna -g0.66 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.66 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 Rv0415 129 hypothetical protein Rv0415 #2 thiC 151 thiC Motif number 1 ATCGTGACGCTAGCGCGCTAGCGTG 1 6 1 GACGCTAGCG 0.970179 -124 TACAGGGTTCCACGCTAGCGCGCTAGCGTC 1 16 0 CACGCTAGCG 0.987784 -114 ACTCTCAGACCCCGCTCCCGGGACTCCCGT 1 49 0 CCCGCTCCCG 0.655074 -81 ACGGTAAGGGCAGGCGCGCCCACTCTCAGA 1 70 0 CAGGCGCGCC 0.923999 -60 GATCAGGTGTGACGGTAAGGGCAGGCGCGC 1 81 0 GACGGTAAGG 0.816526 -49 CCGGCATGATCCGGATCAGGTGTGACGGTA 1 94 0 CCGGATCAGG 0.718433 -36 CCGGATCATGCCGGCGAAGGGAGGTCAAGG 1 110 1 CCGGCGAAGG 0.734514 -20 CGCGGCATCGGGCCGTCCGTG 2 2 1 GCGGCATCGG 0.923944 -150 CGCCGGTGTGCACGGACGGCCCGATGCCGC 2 12 0 CACGGACGGC 0.688552 -140 CTAGCGCAGCGCGGCGCCGGTGTGCACGGA 2 26 0 GCGGCGCCGG 0.501929 -126 TGGGTACCCCCACGCTAGCGCAGCGCGGCG 2 40 0 CACGCTAGCG 0.987784 -112 GGCGTGCGCTCCCGCGTGGGTACCCCCACG 2 56 0 CCCGCGTGGG 0.520852 -96 CTCAGCGCACTCGGCGTGCGCTCCCGCGTG 2 68 0 TCGGCGTGCG 0.950323 -84 CGCTGAGAGGACGGCTCGGGGCCGTCGACC 2 91 1 ACGGCTCGGG 0.775102 -61 CGGCTCGGGGCCGTCGACCGTACGAACCTG 2 102 1 CCGTCGACCG 0.763324 -50 GCCGGCATTACCCGGTCAGGTTCGTACGGT 2 118 0 CCCGGTCAGG 0.95237 -34 CCGGGTAATGCCGGCGTAGGGAGTTGCAA 2 133 1 CCGGCGTAGG 0.890599 -19 ********** Masking position 4 Map Score: 37.6102 Number of sites scoring better than the average of aligned sites = 39926 Number in coding regions = 36877 Number in noncoding regions = 3049 Number of orfs with sites within 600 bp upstream = 1245 Fraction of orfs with sites within 600 bp upstream = 0.199968 Motif number 2 ATCGTGACGCTAGCGCGCTAGCGTGGAACC 1 10 1 CTAGCGCCTA 0.932927 -120 CCTGTAGACACGGGAGTCCCGGGAGCGGGGT 1 40 1 CGGGAGTCCG 0.519328 -90 TAAGGGCAGGCGCGCCCACTCTCAGACCCCG 1 65 0 CGCGCCCCTC 0.972444 -65 CCTTGACCTCCCTTCGCCGGCA 1 118 0 CTTGACCCCC 0.9553 -12 TCGGGCCGTCCGTGCACACCGGCGCCGCGCT 2 18 1 CGTGCACCCG 0.992077 -134 TACCCCCACGCTAGCGCAGCGCGGCGCCGGT 2 35 0 CTAGCGCGCG 0.976321 -117 TGCGCTCCCGCGTGGGTACCCCCACGCTAGC 2 51 0 CGTGGGTCCC 0.984855 -101 GCGCACTCGGCGTGCGCTCCCGCGTGGGTAC 2 63 0 CGTGCGCCCC 0.998892 -89 GAGCGCACGCCGAGTGCGCTGAGAGGACGGC 2 75 1 CGAGTGCCTG 0.980012 -77 TTCGTACGGTCGACGGCCCCGAGCCGTCCTC 2 97 0 CGACGGCCCG 0.626986 -55 ******* *** Masking position 1 Map Score: 14.5173 Number of sites scoring better than the average of aligned sites = 14062 Number in coding regions = 13073 Number in noncoding regions = 989 Number of orfs with sites within 600 bp upstream = 676 Fraction of orfs with sites within 600 bp upstream = 0.108577 Motif number 3 CTGTAGACACGGGAGTCCCGGGAGCGGGGT 1 41 1 GGGAGTCCCG 0.930207 -89 GTCTGAGAGTGGGCGCGCCTGCCCTTACCG 1 69 1 GGGCGCGCCT 0.517272 -61 ACCTGATCCGGATCATGCCGGCGAAGGGAG 1 103 1 GATCATGCCG 0.883395 -27 CGCGGCATCGGGCCGTCCGTGCACA 2 6 1 CATCGGGCCG 0.895125 -146 AGCGCGGCGCCGGTGTGCACGGACGGCCCG 2 19 0 CGGTGTGCAC 0.789977 -133 CACGCTAGCGCAGCGCGGCGCCGGTGTGCA 2 30 0 CAGCGCGGCG 0.626711 -122 GCTCCCGCGTGGGTACCCCCACGCTAGCGC 2 49 0 GGGTACCCCC 0.789609 -103 GTACCCACGCGGGAGCGCACGCCGAGTGCG 2 63 1 GGGAGCGCAC 0.785095 -89 AGCGCACGCCGAGTGCGCTGAGAGGACGGC 2 76 1 GAGTGCGCTG 0.80654 -76 AACCTGACCGGGTAATGCCGGCGTAGGGAG 2 126 1 GGTAATGCCG 0.933052 -26 ********** Masking position 8 Map Score: 9.96799 Number of sites scoring better than the average of aligned sites = 35085 Number in coding regions = 32475 Number in noncoding regions = 2610 Number of orfs with sites within 600 bp upstream = 1184 Fraction of orfs with sites within 600 bp upstream = 0.19017 Motif number 4 CCTTGACCTCCCTTCGCCGGCATGAT 1 114 0 CCTCCCTTCG 0.997388 -16 CACACCGGCGCCGCGCTGCGCTAGCGTGGG 2 32 1 CCGCGCTGCG 0.996966 -120 CCCGAGCCGTCCTCTCAGCGCACTCGGCGT 2 81 0 CCTCTCAGCG 0.993439 -71 TTGCAACTCCCTACGCCGGCATTAC 2 137 0 ACTCCCTACG 0.98973 -15 ********** Masking position 6 Map Score: 4.88989 Number of sites scoring better than the average of aligned sites = 501 Number in coding regions = 449 Number in noncoding regions = 52 Number of orfs with sites within 600 bp upstream = 48 Fraction of orfs with sites within 600 bp upstream = 0.0077096 Motif number 5 ********** No masking Map Score: -3.17312e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -3.17312e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -3.17312e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0