AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i203_dna_repair_mtub_reg_100.orf -a/home/amcguire/alignace/lib/ORF_mtub.txt -z/skink1/amcguire/genomes/mtub.fna -g0.66 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.66 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 lprJ 300 lprJ #2 Rv1691 38 hypothetical protein Rv1691 Motif number 1 AAAGATAAGTCAGGAAGTGGAAATCGACTACA 1 14 0 CGGAGTGGAA 0.956692 -287 CGGCCACCGACTAGTCGTGGGATACCAGCGGA 1 59 0 CAGCGTGGGA 0.993045 -242 CGACTAGTCGGTGGCCGGGGGAAATGCCGAAT 1 74 1 GGGCGGGGGA 0.996731 -227 TCACGATCCACCGGATGCGGGATTCGGCATTT 1 95 0 CGGTGCGGGA 0.998027 -206 GTGAAGTCCACCAATCGGGGGACGATCGGCCC 1 123 1 CAACGGGGGA 0.969268 -178 GGGGGACGATCGGCCCGCGGTGCCCCCCTACC 1 139 1 CGCCGCGGTG 0.946407 -162 GCGCGTTAACCGGGTAGGGGGGCACCGCGGGC 1 151 0 CGGAGGGGGG 0.996859 -150 GCGACAACAACGAGAAGCGGGAG 1 288 1 CAGAGCGGGA 0.995136 -13 TAGTTACGGGGCGCAGCAACCCCCGTAA 2 7 1 CGGCGCAGCA 0.96406 -32 TCGGTAGAGGTTACGGGGGTTGCTGCGC 2 21 0 GGGTACGGGG 0.893819 -18 * ** ******* Masking position 10 Map Score: 16.8189 Number of sites scoring better than the average of aligned sites = 6330 Number in coding regions = 5840 Number in noncoding regions = 490 Number of orfs with sites within 600 bp upstream = 410 Fraction of orfs with sites within 600 bp upstream = 0.0658529 Motif number 2 AAGTGGAAATCGACTACAACG 1 2 0 CGACTACAAC 0.935991 -299 AGTCCAAACCCGCCAAAGATAAGTCAGGAA 1 30 0 CGCCAAAGAT 0.900186 -271 TGGCGGGTTTGGACTCCGCTGGTATCCCAC 1 45 1 GGACTCCGCT 0.955523 -256 CATTTCCCCCGGCCACCGACTAGTCGTGGG 1 70 0 GGCCACCGAC 0.993835 -231 TGCCGAATCCCGCATCCGGTGGATCGTGAA 1 98 1 CGCATCCGGT 0.786678 -203 GGATCGTGAAGTCCACCAATCGGGGGACGA 1 118 1 GTCCACCAAT 0.900188 -183 CCGGGTAGGGGGGCACCGCGGGCCGATCGT 1 144 0 GGGCACCGCG 0.93499 -157 CGACAACAGTGGCCAACAAGAGTCACGTTC 1 236 0 GGCCAACAAG 0.977556 -65 TAAGGCACCTCGACAACAGTGGCCAACAAG 1 246 0 CGACAACAGT 0.949128 -55 GACGCAAGTGCGACAACAACGAGAAGCGGG 1 279 1 CGACAACAAC 0.969965 -22 ********** Masking position 4 Map Score: 7.5085 Number of sites scoring better than the average of aligned sites = 32338 Number in coding regions = 30704 Number in noncoding regions = 1634 Number of orfs with sites within 600 bp upstream = 961 Fraction of orfs with sites within 600 bp upstream = 0.154353 Motif number 3 TCCACTTCCTGACTTATCTTTGGCGGGTTTG 1 25 1 GACTTTCTTT 0.718086 -276 CCCGGCCACCGACTAGTCGTGGGATACCAGC 1 62 0 GACTATCGTG 0.815307 -239 TCCCGCATCCGGTGGATCGTGAAGTCCACCA 1 105 1 GGTGGTCGTG 0.971554 -196 TCGTGAAGTCCACCAATCGGGGGACGATCGG 1 121 1 CACCATCGGG 0.654651 -180 GGGCACCGCGGGCCGATCGTCCCCCGATTGG 1 133 0 GGCCGTCGTC 0.968959 -168 TGCACACTAACGCGTTTCGTGTGGAATGTGT 1 183 0 CGCGTTCGTG 0.931723 -118 GTGCTGTGAACGTGACTCTTGTTGGCCACTG 1 229 1 CGTGATCTTG 0.915532 -72 GACTCTTGTTGGCCACTGTTGTCGAGGTGCC 1 242 1 GGCCATGTTG 0.908581 -59 CTCCCGCTTCTCGTTGTTGTCGCAC 1 286 0 CGCTTTCGTT 0.950291 -15 ***** ***** Masking position 7 Map Score: 4.25036 Number of sites scoring better than the average of aligned sites = 7704 Number in coding regions = 6939 Number in noncoding regions = 765 Number of orfs with sites within 600 bp upstream = 559 Fraction of orfs with sites within 600 bp upstream = 0.0897848 Motif number 4 CGTTAACCGGGTAGGGGGGCACCGCGGGCCGAT 1 147 0 GTAGGGCACC 0.984523 -154 CCCCTACCCGGTTAACGCGCACACATTCCACAC 1 163 1 GTTAGGCACA 0.997931 -138 CACGAAACGCGTTAGTGTGCAAACCTTTATCCC 1 193 1 GTTAGGCAAA 0.991705 -108 TAGTTACGGGGCGCAGCAACCCCCG 2 3 1 GTTAGGCGCA 0.996474 -36 **** * ***** Masking position 2 Map Score: 0.985217 Number of sites scoring better than the average of aligned sites = 34 Number in coding regions = 28 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 8 Fraction of orfs with sites within 600 bp upstream = 0.00128493 Motif number 5 ********** No masking Map Score: 7.2008e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 7.2008e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 7.2008e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0