AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i207_holliday_junction_mtub_reg_300.orf -a/home/amcguire/alignace/lib/ORF_mtub.txt -z/skink1/amcguire/genomes/mtub.fna -g0.66 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.66 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 ruvC 108 ruvC Motif number 1 AATTTACCATCGCACGTTCCATAGGCGTGT 1 18 1 CGCACGTTCC 0.958956 -91 CGACATCCCGCGCAGGACACGCCTATGGAA 1 34 0 CGCAGGACAC 0.992813 -75 GCGGGATGTCGGGACGATCCGCTAGCGTAT 1 53 1 GGGACGATCC 0.58881 -56 TCCGAACAATCGTTCGATACGCTAGCGGAT 1 69 0 CGTTCGATAC 0.987013 -40 CGCACGCTCCCTCAGCCATT 1 99 0 CGCACGCTCC 0.996199 -10 ********** Masking position 6 Map Score: 10.1079 Number of sites scoring better than the average of aligned sites = 1011 Number in coding regions = 923 Number in noncoding regions = 88 Number of orfs with sites within 600 bp upstream = 95 Fraction of orfs with sites within 600 bp upstream = 0.0152586 Motif number 2 CCTATGGAACGTGCGATGGTAAATTTCCTA 1 13 0 GTGCGATGGT 0.988207 -96 GCGCAGGACACGCCTATGGAACGTGCGATG 1 25 0 CGCCTATGGA 0.987205 -84 TAGGCGTGTCCTGCGCGGGATGTCGGGACG 1 39 1 CTGCGCGGGA 0.988557 -70 TCGGGACGATCCGCTAGCGTATCGAACGAT 1 61 1 CCGCTAGCGT 0.813232 -48 GTTCGGAAATGGCTGAGGGAGCGTGCG 1 92 1 GGCTGAGGGA 0.981791 -17 ********** Masking position 9 Map Score: 2.28942 Number of sites scoring better than the average of aligned sites = 7370 Number in coding regions = 6803 Number in noncoding regions = 567 Number of orfs with sites within 600 bp upstream = 457 Fraction of orfs with sites within 600 bp upstream = 0.0734019 Motif number 3 GCGATGGTAAATTTCCTACC 1 1 0 ATTTCCTACC 0.992728 -108 TTCCATAGGCGTGTCCTGCGCGGGATGTCG 1 34 1 GTGTCCTGCG 0.986269 -75 CCTGCGCGGGATGTCGGGACGATCCGCTAG 1 48 1 ATGTCGGGAC 0.991701 -61 TCCCTCAGCCATTTCCGAACAATCGTTCGA 1 82 0 ATTTCCGAAC 0.992263 -27 ********** Masking position 4 Map Score: 2.50911 Number of sites scoring better than the average of aligned sites = 732 Number in coding regions = 663 Number in noncoding regions = 69 Number of orfs with sites within 600 bp upstream = 74 Fraction of orfs with sites within 600 bp upstream = 0.0118856 Motif number 4 ********** No masking Map Score: 1.37435e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.37435e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 1.37435e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0