AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i243_regulatory_mtub_reg_300.orf -a/home/amcguire/alignace/lib/ORF_mtub.txt -z/skink1/amcguire/genomes/mtub.fna -g0.66 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.66 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 Rv0823c 87 hypothetical protein Rv0823c #2 desA1 161 desA1 #3 Rv0825c 80 hypothetical protein Rv0825c Motif number 1 CCCGGCGACGATGCAGAGCGCGCA 1 4 1 GCGACGATGC 0.990582 -84 CGACGATGCAGAGCGCGCAGCGCGATGAGCA 1 16 1 GGCGCGCAGC 0.997129 -72 GCAGCGCGATGAGCAGGAGGCGGGCAATCCA 1 32 1 GGCAGGAGGC 0.995492 -56 AACCCAGCCCGGCGACGATGCAGAGCGCGCA 1 62 1 GCGACGATGC 0.990582 -26 CGACGATGCAGAGCGCGCAGCGCG 1 74 1 GGCGCGCAGC 0.997129 -14 CTGGGGTTCACCCCACGCGGCCACCGGGGCC 2 17 1 CCCACGCGGC 0.995668 -145 GCCACCGGGGCCCGCCGATGCCAGCATCCTG 2 36 1 CCGCCGATGC 0.963875 -126 TGCCAGCAGCGGGCAGGATGCTGGCATCGGC 2 49 0 GGCAGGATGC 0.994563 -113 ATCCTGCCCGCTGCTGGCAGCTCAACATGCC 2 61 1 CGCTGGCAGC 0.977134 -101 GCTCAACATGCCGCGCGAAGCCCAAACTTGA 2 80 1 CGCGCGAAGC 0.995415 -82 ACACAGATAACTGGAGGCGCC 2 151 1 CGGAGGCGCC 0.944168 -11 * ********* Masking position 11 Map Score: 26.2623 Number of sites scoring better than the average of aligned sites = 10699 Number in coding regions = 10047 Number in noncoding regions = 652 Number of orfs with sites within 600 bp upstream = 459 Fraction of orfs with sites within 600 bp upstream = 0.0737231 Motif number 2 CCCGGCGACGATGCAGAGCG 1 1 1 CCCGGCGACG 0.97372 -87 CGACGATGCAGAGCGCGCAGCGCGATGAGC 1 16 1 GAGCGCGCAG 0.968441 -72 GCGCGATGAGCAGGAGGCGGGCAATCCAAC 1 35 1 CAGGAGGCGG 0.972734 -53 TCCAACCCAGCCCGGCGACGATGCAGAGCG 1 59 1 CCCGGCGACG 0.97372 -29 CGACGATGCAGAGCGCGCAGCGCG 1 74 1 GAGCGCGCAG 0.968441 -14 CTGGGGTTCACCCCACGCGGCCACCGGGGC 2 17 1 CCCCACGCGG 0.779457 -145 CACGCGGCCACCGGGGCCCGCCGATGCCAG 2 30 1 CCGGGGCCCG 0.930168 -132 GAGCTGCCAGCAGCGGGCAGGATGCTGGCA 2 54 0 CAGCGGGCAG 0.959805 -108 GCGGCATGTTGAGCTGCCAGCAGCGGGCAG 2 64 0 GAGCTGCCAG 0.850166 -98 GCTCAACATGCCGCGCGAAGCCCAAACTTG 2 80 1 CCGCGCGAAG 0.768023 -82 AATGAAGATTCAGCAGGCAAAACCACCA 3 9 0 CAGCAGGCAA 0.924051 -72 ********** Masking position 10 Map Score: 22.124 Number of sites scoring better than the average of aligned sites = 24788 Number in coding regions = 23003 Number in noncoding regions = 1785 Number of orfs with sites within 600 bp upstream = 967 Fraction of orfs with sites within 600 bp upstream = 0.155316 Motif number 3 GCGACGATGCAGAGCGCGCAGCGCGATGAG 1 15 1 AGAGCGCGCA 0.691963 -73 CGCAGCGCGATGAGCAGGAGGCGGGCAATC 1 31 1 TGAGCAGGAG 0.825092 -57 CTCTGCATCGTCGCCGGGCTGGGTTGGATT 1 57 0 TCGCCGGGCT 0.945615 -31 GCGACGATGCAGAGCGCGCAGCGCG 1 73 1 AGAGCGCGCA 0.691963 -15 CGTGGGGTGAACCCCAGTCGTCC 2 4 0 ACCCCAGTCG 0.747477 -158 ACTGGGGTTCACCCCACGCGGCCACCGGGG 2 16 1 ACCCCACGCG 0.973627 -146 GATGCTGGCATCGGCGGGCCCCGGTGGCCG 2 34 0 TCGGCGGGCC 0.965665 -128 TGAGCTGCCAGCAGCGGGCAGGATGCTGGC 2 55 0 GCAGCGGGCA 0.943613 -107 GCAGCTCAACATGCCGCGCGAAGCCCAAAC 2 77 1 ATGCCGCGCG 0.936849 -85 CAATGAAGATTCAGCAGGCAAAACCACCA 3 10 0 TCAGCAGGCA 0.976725 -71 GAATCTTCATTGGCCACACGAATTCTGACT 3 28 1 TGGCCACACG 0.849771 -53 ACACGAATTCTGACTACGCACGTTGTCACT 3 43 1 TGACTACGCA 0.672985 -38 ********** Masking position 5 Map Score: 12.329 Number of sites scoring better than the average of aligned sites = 28491 Number in coding regions = 26206 Number in noncoding regions = 2285 Number of orfs with sites within 600 bp upstream = 1141 Fraction of orfs with sites within 600 bp upstream = 0.183264 Motif number 4 GCTACCGAGAGACACAGATATATTGACTGC 2 112 1 GACACAGATA 0.997399 -50 GCAACCATTAGACACAGATAACTGGAGGCG 2 140 1 GACACAGATA 0.997399 -22 ********** Masking position 6 Map Score: 1.87981 Number of sites scoring better than the average of aligned sites = 2 Number in coding regions = 0 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 5 ********** No masking Map Score: 1.3033e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 1.3033e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 1.3033e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0