AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i264_hypothetical1_mtub_reg_100.orf -a/home/amcguire/alignace/lib/ORF_mtub.txt -z/skink1/amcguire/genomes/mtub.fna -g0.66 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.66 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 Rv1419 179 hypothetical protein Rv1419 #2 uvrC 63 uvrC Motif number 1 CGCCAGCCCCCATGCTCTTCGCGG 1 1 1 CGCCAGCCCG 0.995497 -179 GCCGGTTCAAACCCGCCCGCGAAGAGCATGGGGG 1 17 0 ACCCGCCCGG 0.993512 -163 GTGACTTTGACCCCGTTTGGCCGGTTCAAACCCG 1 36 0 CCCCGTTTCG 0.957967 -144 TTTGAGTATGCCCAGGCCGCCGTGACTTTGACCC 1 57 0 CCCAGGCCCG 0.998493 -123 CAAATGTGTCCCACGGCCCACCATCGGATCCCGA 1 87 1 CCACGGCCCT 0.994718 -93 CGGATCCCGACGACGGCCCACTGTGAACTGCGCC 1 111 1 CGACGGCCCT 0.990925 -69 CTGTGAACTGCGCCGCTCGTGGTGCATTACCCAG 1 131 1 CGCCGCTCGG 0.935494 -49 TGGTGCATTACCCAGACCACGATGAGAGAATGGC 1 150 1 CCCAGACCGG 0.985583 -30 TTCCCCGCCATTCTCTCATCGTGGTC 1 164 0 CCCCGCCACT 0.989749 -16 GGCGGGGGTTCGCCGGGCAGGCCGG 2 2 0 CGCCGGGCGG 0.981857 -62 CCCGGCGAACCCCCGCCTTTCTGGGCGCCGTCGA 2 19 1 CCCCGCCTCG 0.99849 -45 ******** * * Masking position 5 Map Score: 26.0814 Number of sites scoring better than the average of aligned sites = 16157 Number in coding regions = 15275 Number in noncoding regions = 882 Number of orfs with sites within 600 bp upstream = 619 Fraction of orfs with sites within 600 bp upstream = 0.0994218 Motif number 2 TCAAACCCGCCCGCGAAGAGCATGGGGGCT 1 15 0 CCGCGAAGAG 0.965815 -165 TATGCCCAGGCCGCCGTGACTTTGACCCCG 1 55 0 CCGCCGTGAC 0.989451 -125 GTCCCACGGCCCACCATCGGATCCCGACGA 1 94 1 CCACCATCGG 0.981537 -86 TCACAGTGGGCCGTCGTCGGGATCCGATGG 1 107 0 CCGTCGTCGG 0.649442 -73 CGACGACGGCCCACTGTGAACTGCGCCGCT 1 118 1 CCACTGTGAA 0.943177 -62 TCTGGGTAATGCACCACGAGCGGCGCAGTT 1 136 0 GCACCACGAG 0.976057 -44 ATTACCCAGACCACGATGAGAGAATGGCGG 1 156 1 CCACGATGAG 0.988488 -24 CCGGCCTGCCCGGCGAACCCCCGCCTT 2 8 1 GCCCGGCGAA 0.896584 -56 GCCTTTCTGGGCGCCGTCGAAGCGACCACT 2 33 1 GCGCCGTCGA 0.972436 -31 ********** Masking position 2 Map Score: 9.50396 Number of sites scoring better than the average of aligned sites = 21688 Number in coding regions = 20213 Number in noncoding regions = 1475 Number of orfs with sites within 600 bp upstream = 848 Fraction of orfs with sites within 600 bp upstream = 0.136203 Motif number 3 GCGAAGAGCATGGGGGCTGGCG 1 2 0 TGGGGGTGGC 0.878884 -178 CCAGCCCCCATGCTCTTCGCGGGCGGGTTTG 1 13 1 TGCTCTCGCG 0.896155 -167 CCAGGCCGCCGTGACTTTGACCCCGTTTGGC 1 49 0 GTGACTTGAC 0.894676 -131 TGGGACACATTTGAGTATGCCCAGGCCGCCG 1 69 0 TTGAGTTGCC 0.95448 -111 TCCGATGGTGGGCCGTGGGACACATTTGAGT 1 84 0 GGCCGTGGAC 0.711087 -96 CGGCCCACTGTGAACTGCGCCGCTCGTGGTG 1 124 1 TGAACTCGCC 0.940943 -56 CCAGAAAGGCGGGGGTTCGCCGGGCAGGCCG 2 12 0 GGGGGTCGCC 0.98861 -52 ACCCCCGCCTTTCTGGGCGCCGTCGAAGCGA 2 27 1 TTCTGGCGCC 0.945912 -37 TAGGCTAGTGGTCGCTTCGACGGCGCCCAGA 2 38 0 GTCGCTCGAC 0.915159 -26 ****** **** Masking position 9 Map Score: 1.73994 Number of sites scoring better than the average of aligned sites = 24315 Number in coding regions = 22579 Number in noncoding regions = 1736 Number of orfs with sites within 600 bp upstream = 990 Fraction of orfs with sites within 600 bp upstream = 0.159011 Motif number 4 TGCTCTTCGCGGGCGGGTTTGAACCGGCCA 1 23 1 GGGCGGGTTT 0.944712 -157 TGACCCCGTTTGGCCGGTTCAAACCCGCCC 1 33 0 TGGCCGGTTC 0.989629 -147 GAGTATGCCCAGGCCGCCGTGACTTTGACC 1 58 0 AGGCCGCCGT 0.935117 -122 CCGGCCTGCCCGGCGAACCCCCGCCT 2 7 1 TGCCCGGCGA 0.957238 -57 CCCGCCTTTCTGGGCGCCGTCGAAGCGACC 2 30 1 TGGGCGCCGT 0.967298 -34 TCTAGGCTAGTGGTCGCTTCGACGGCGCCC 2 41 0 TGGTCGCTTC 0.971665 -23 ********** Masking position 6 Map Score: 4.4185 Number of sites scoring better than the average of aligned sites = 13027 Number in coding regions = 12314 Number in noncoding regions = 713 Number of orfs with sites within 600 bp upstream = 527 Fraction of orfs with sites within 600 bp upstream = 0.084645 Motif number 5 ********** No masking Map Score: -3.30951e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -3.30951e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -3.30951e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0