AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i270_hypothetical15_mtub_reg_100.orf -a/home/amcguire/alignace/lib/ORF_mtub.txt -z/skink1/amcguire/genomes/mtub.fna -g0.66 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.66 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 ftsZ 172 ftsZ Motif number 1 CCGAAAAAATGCCCGCCGCGTATCGGCG 1 9 1 ATGCCCGCCG 0.97201 -164 CTAACCGTGCAGGCGCGCCGATACGCGGCG 1 24 0 AGGCGCGCCG 0.6562 -149 GCTACGACGGTTGCTAACCGTGCAGGCGCG 1 37 0 TTGCTAACCG 0.977074 -136 TGTCAAGTAGTTGCTCGTAGTCAGAACCGT 1 70 0 TTGCTCGTAG 0.969599 -103 GGTTGAGAGTTTGCCAGCAGACACACCGAA 1 121 1 TTGCCAGCAG 0.931038 -52 ********** Masking position 4 Map Score: 7.77189 Number of sites scoring better than the average of aligned sites = 3367 Number in coding regions = 3101 Number in noncoding regions = 266 Number of orfs with sites within 600 bp upstream = 250 Fraction of orfs with sites within 600 bp upstream = 0.0401542 Motif number 2 ATGGCTACGACGGTTGCTAACCGTGCAGGCGC 1 38 0 CGGTTCTACC 0.912374 -135 TAGCAACCGTCGTAGCCATACGGTTCTGACTA 1 51 1 CGTAGCAACG 0.828787 -122 AGTAGTTGCTCGTAGTCAGAACCGTATGGCTA 1 63 0 CGTAGCAAAC 0.99427 -110 ACGAGCAACTACTTGACATAACTCTAAGCCTA 1 82 1 ACTTGCAAAC 0.939329 -91 AGAGTTTGCCAGCAGACACACCGAAGAACCGA 1 126 1 AGCAGCAACC 0.990305 -47 CACCGAAGAACCGAGCCCCACCAGGGAGGAAG 1 144 1 CCGAGCCACC 0.994965 -29 CCCACCAGGGAGGAAGCCGAACG 1 160 1 AGGAACCAAC 0.944463 -13 ***** ** *** Masking position 10 Map Score: 4.20334 Number of sites scoring better than the average of aligned sites = 3740 Number in coding regions = 3414 Number in noncoding regions = 326 Number of orfs with sites within 600 bp upstream = 294 Fraction of orfs with sites within 600 bp upstream = 0.0472213 Motif number 3 TCAGAACCGTATGGCTACGACGGTTGCTAA 1 50 0 ATGGCTACGA 0.996839 -123 CCATACGGTTCTGACTACGAGCAACTACTT 1 66 1 CTGACTACGA 0.996839 -107 ********** Masking position 6 Map Score: 0.272707 Number of sites scoring better than the average of aligned sites = 16 Number in coding regions = 11 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 4 GGTTAGCAACCGTCGTAGCCATACGGTTCT 1 48 1 CGTCGTAGCC 0.98301 -125 AGTTGCTCGTAGTCAGAACCGTATGGCTAC 1 62 0 AGTCAGAACC 0.984478 -111 ACTTGACATAACTCTAAGCCTATGGTTGAG 1 92 1 ACTCTAAGCC 0.991579 -81 CTGCTGGCAAACTCTCAACCTCAACCATAG 1 111 0 ACTCTCAACC 0.991178 -62 ********** Masking position 7 Map Score: 1.29413 Number of sites scoring better than the average of aligned sites = 139 Number in coding regions = 118 Number in noncoding regions = 21 Number of orfs with sites within 600 bp upstream = 22 Fraction of orfs with sites within 600 bp upstream = 0.00353357 Motif number 5 ********** No masking Map Score: 1.51646e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 1.51646e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 1.51646e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0