AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i277_hypothetical21_mtub_reg_100.orf -a/home/amcguire/alignace/lib/ORF_mtub.txt -z/skink1/amcguire/genomes/mtub.fna -g0.66 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.66 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 Rv2435c 300 hypothetical protein Rv2435c Motif number 1 CACATGCCCCGGCACCGGCAACCGCTGCGGAGTG 1 6 0 GACGCGCGCG 0.963046 -295 ATAGCTCGGCCGTATCGCAATGTTCAGCGAGTCGATGGA 1 49 0 CACGGTCGCG 0.989012 -252 TGGGTGGTCCGTAATCGAGGTGAGCCAGGATAGCTCGGC 1 78 0 GACGGGCAGG 0.991219 -223 CTTGAGGGGTGGTAGCGATTGGTTCTGGGTGGTCCGTAA 1 103 0 GACGGTCGGG 0.998445 -198 TCCTCGTCGCGCACGCGCTTCTTGAGGGGTGGTAGCGAT 1 123 0 GCCGTGAGGG 0.942863 -178 CCGCGTACGGGTCCTCGTCATCGTCCTCGTCGCGCACGC 1 146 0 GCCGCTCTCG 0.996006 -155 ACGAGGACCCGTACGCGGCGCATTCCTCGATTGGTCGCT 1 167 1 GCCGATCTCG 0.9795 -134 TTCCTCGATTGGTCGCTGGTGGCTTTTCGGCAAACGCGA 1 189 1 GCCTGTTTCG 0.820189 -112 TGGCTTTTCGGCAAACGCGATGATCGTGGGCTGGGCACG 1 208 1 GACGGTCTGG 0.996208 -93 TCGTGGGCTGGGCACGTTAGTCTGCTGCGTAATCGGCGC 1 231 1 GAGTCGCGCG 0.937824 -70 AGAGCAGCCTGCGACCGACAGCAGAGGGGAAGCCGG 1 275 1 GACGCGAGGG 0.991811 -26 * * ** * ** *** Masking position 19 Map Score: 17.1653 Number of sites scoring better than the average of aligned sites = 19430 Number in coding regions = 18512 Number in noncoding regions = 918 Number of orfs with sites within 600 bp upstream = 629 Fraction of orfs with sites within 600 bp upstream = 0.101028 Motif number 2 CACTCCGCAGCGGTTGCCGGTGCCGGGGCAT 1 10 1 GCGGTTGCGT 0.961757 -291 GGTTGCCGGTGCCGGGGCATGTGTTGATCCAT 1 22 1 GCCGGGGCGT 0.983483 -279 GCAATGTTCAGCGAGTCGATGGATCAACACAT 1 40 0 GCGAGTCGGG 0.93403 -261 AGCCAGGATAGCTCGGCCGTATCGCAATGTTC 1 63 0 GCTCGGCCAT 0.939254 -238 CCCTCAAGAAGCGCGTGCGCGACGAGGACGAT 1 134 1 GCGCGTGCGA 0.98611 -167 TGCGCCGCGTACGGGTCCTCGTCATCGTCCTC 1 157 0 ACGGGTCCGT 0.774359 -144 GAGGACCCGTACGCGGCGCATTCCTCGATTGG 1 169 1 ACGCGGCGTT 0.93533 -132 TCGATTGGTCGCTGGTGGCTTTTCGGCAAACG 1 193 1 GCTGGTGGTT 0.961617 -108 ATGATCGTGGGCTGGGCACGTTAGTCTGCTGC 1 227 1 GCTGGGCATT 0.883907 -74 TGCGTAATCGGCGCGTCGTAGAGCAGCCTGCG 1 256 1 GCGCGTCGGA 0.988738 -45 ******** ** Masking position 2 Map Score: 8.57135 Number of sites scoring better than the average of aligned sites = 17320 Number in coding regions = 16076 Number in noncoding regions = 1244 Number of orfs with sites within 600 bp upstream = 831 Fraction of orfs with sites within 600 bp upstream = 0.133473 Motif number 3 TCGGCCGTATCGCAATGTTCAGCGAGTCGA 1 53 0 CGCAATGTTC 0.986123 -248 GGTCCGTAATCGAGGTGAGCCAGGATAGCT 1 82 0 CGAGGTGAGC 0.958674 -219 GGGGTGGTAGCGATTGGTTCTGGGTGGTCC 1 107 0 CGATTGGTTC 0.887369 -194 CCGTACGCGGCGCATTCCTCGATTGGTCGC 1 175 1 CGCATTCCTC 0.956115 -126 TTTCGGCAAACGCGATGATCGTGGGCTGGG 1 213 1 CGCGATGATC 0.981663 -88 TGCTGTCGGTCGCAGGCTGCTCTACGACGC 1 268 0 CGCAGGCTGC 0.975301 -33 ********** Masking position 2 Map Score: 1.36134 Number of sites scoring better than the average of aligned sites = 6305 Number in coding regions = 5887 Number in noncoding regions = 418 Number of orfs with sites within 600 bp upstream = 365 Fraction of orfs with sites within 600 bp upstream = 0.0586251 Motif number 4 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0