AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i282_hypothetical7_mtub_reg_300.orf -a/home/amcguire/alignace/lib/ORF_mtub.txt -z/skink1/amcguire/genomes/mtub.fna -g0.66 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.66 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 Rv0038 101 hypothetical protein Rv0038 #2 alaS 90 alaS #3 Rv2556c 106 hypothetical protein Rv2556c Motif number 1 AGGCAAGGTTCGGTCCACCCCGTGCCGCCC 1 10 1 TCGGCCACCC 0.998605 -92 TGTACTGTGGTTGGGGCGGCACGGGGTGGAC 1 23 0 TTGGGCGGCA 0.903405 -79 AGTACAAATATTCGCCGACCCTGCTTGTTCG 1 48 1 TTCGCGACCC 0.984975 -54 CCGACCCTGCTTGTTCGCCCCGGGCGATGCG 1 62 1 TTGTCGCCCC 0.943682 -40 CGCACCACCGTCGCATCGCCCGGGGCGAACA 1 73 0 TCGCTCGCCC 0.993354 -29 ACCATCATCGCACCACCGTCGCATCGCC 1 84 0 TCGCCCACCG 0.973696 -18 GAGAAGGCTGTCCGACGGCCCAATTCGGCCC 2 13 0 TCCGCGGCCC 0.997468 -78 ATTACCTTCCTCCGACGGGCCGGCCGGGGCA 3 13 1 TCCGCGGGCC 0.995067 -94 GGATTGCCCATTGCCCCGGCCGGCCCGTCGG 3 24 0 TTGCCCGGCC 0.99499 -83 TCCATTGACGTCGGATTGCCCATTGCCCCGG 3 36 0 TCGGTTGCCC 0.974113 -71 GATTGGCAGGTTGGCGCGCCCCCACCGTAGG 3 65 1 TTGGGCGCCC 0.995706 -42 CGGTATCCACCCGTCCCAGCCTACGGTGGGG 3 84 0 CCGTCCAGCC 0.925283 -23 **** ****** Masking position 10 Map Score: 25.3122 Number of sites scoring better than the average of aligned sites = 10036 Number in coding regions = 9229 Number in noncoding regions = 807 Number of orfs with sites within 600 bp upstream = 523 Fraction of orfs with sites within 600 bp upstream = 0.0840026 Motif number 2 AGGCAAGGTTCGGTCCACCCCGTGCCGC 1 9 1 TTCGGTCCAC 0.928749 -93 TTGTACTGTGGTTGGGGCGGCACGGGGTGG 1 25 0 GTTGGGGCGG 0.968737 -77 ACCCTGCTTGTTCGCCCCGGGCGATGCGAC 1 65 1 TTCGCCCCGG 0.99338 -37 TCGCACCACCGTCGCATCGCCCGGGGCGAA 1 75 0 GTCGCATCGC 0.989853 -27 ACCATCATCGCACCACCGTCGCATCG 1 86 0 ATCGCACCAC 0.94579 -16 GACGGCCCAATTCGGCCCGC 2 1 0 TTCGGCCCGC 0.997664 -90 GAATTGGGCCGTCGGACAGCCTTCTCATAA 2 18 1 GTCGGACAGC 0.985883 -73 ACCTTCCTCCGACGGGCCGGCCGGGGCAAT 3 16 1 GACGGGCCGG 0.981193 -91 CGGATTGCCCATTGCCCCGGCCGGCCCGTC 3 26 0 ATTGCCCCGG 0.962885 -81 ATCCATTGACGTCGGATTGCCCATTGCCCC 3 38 0 GTCGGATTGC 0.936005 -69 GGATTGGCAGGTTGGCGCGCCCCCACCGTA 3 64 1 GTTGGCGCGC 0.990054 -43 ********** Masking position 4 Map Score: 20.1624 Number of sites scoring better than the average of aligned sites = 14164 Number in coding regions = 12991 Number in noncoding regions = 1173 Number of orfs with sites within 600 bp upstream = 782 Fraction of orfs with sites within 600 bp upstream = 0.125602 Motif number 3 AGGCAAGGTTCGGTCCACCCCGTGCCGCCC 1 10 1 TCGGTCACCC 0.895643 -92 CCACCCCGTGCCGCCCCAACCACAGTACAAA 1 25 1 CCGCCCAACC 0.987 -77 ATTCGCCGACCCTGCTTGTTCGCCCCGGGCG 1 57 1 CCTGCTGTTC 0.826531 -45 CTTGTTCGCCCCGGGCGATGCGACGGTGGTG 1 71 1 CCGGGCATGC 0.95852 -31 GGCTGTCCGACGGCCCAATTCGGCCCGC 2 8 0 CGGCCCATTC 0.953013 -83 GGGCCGTCGGACAGCCTTCTCATAATCCGGC 2 23 1 ACAGCCTCTC 0.864432 -68 AAGTCCATTACCAGCCTATTCGCCGGATTAT 2 44 0 CCAGCCATTC 0.992806 -47 GCCCATTGCCCCGGCCGGCCCGTCGGAGGAA 3 19 0 CCGGCCGCCC 0.998021 -88 GGCGCGCCAACCTGCCAATCCATTGACGTCG 3 54 0 CCTGCCATCC 0.994743 -53 ATCGGTATCCACCCGTCCCAGCCTACGGT 3 88 0 CCACCCTCCC 0.982665 -19 ****** **** Masking position 11 Map Score: 13.8087 Number of sites scoring better than the average of aligned sites = 12304 Number in coding regions = 11495 Number in noncoding regions = 809 Number of orfs with sites within 600 bp upstream = 594 Fraction of orfs with sites within 600 bp upstream = 0.0954064 Motif number 4 ********** No masking Map Score: 5.70866e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 5.70866e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 5.70866e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0