AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i288_moxr_hypothetical_mtub_reg_300.orf -a/home/amcguire/alignace/lib/ORF_mtub.txt -z/skink1/amcguire/genomes/mtub.fna -g0.66 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.66 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 Rv1476 157 hypothetical protein Rv1476 #2 Rv1477 225 hypothetical protein Rv1477 #3 moxR 138 moxR Motif number 1 GTCGACACGGCCCGTCGGCGGGCGAACCAAA 1 26 0 CCCGTCGCGG 0.993899 -132 GCCGACGGGCCGTGTCGACGGCGTGGTGTCA 1 38 1 CGTGTCGCGG 0.998989 -120 GTGTCGACGGCGTGGTGTCAGCCTAGCAGTA 1 49 1 CGTGGTGCAG 0.938884 -109 GCTTTGTTGCCGTGTGGGTGCGCGCCGAAGT 1 90 1 CGTGTGGTGC 0.989788 -68 GCGCTGCTCGCACTTCGGCGCGCACCCACAC 1 101 0 CACTTCGCGC 0.963164 -57 GTGCCAGTAGCACGTCGGCAGGAAGGATGCG 1 137 1 CACGTCGCAG 0.991417 -21 AGAAGAGATAGATGTGGCTGG 2 1 0 GATGTGGTGG 0.907083 -225 TATCTCTTCTCGTGTTGCCGCGCTAACCGGG 2 22 1 CGTGTTGCGC 0.990343 -204 GCGGCAAACGCGCGAGGTCACCGTTGGGTCA 2 62 1 CGCGAGGCAC 0.965454 -164 GCGAGGTCACCGTTGGGTCACATTAGTCGCA 2 73 1 CGTTGGGCAC 0.766736 -153 TGATGCTTGTGGTGTCGTTGGCGTTGACCTG 2 165 1 GGTGTCGTGG 0.988038 -61 GCACCACCGCGGCGTCGACGGAATCCAGGAG 3 30 1 GGCGTCGCGG 0.997268 -109 TGAACGCGGGCGCGTCGCTGCCCCGCGACGT 3 73 1 CGCGTCGTGC 0.996679 -66 GTCGCTGCCCCGCGACGTTGGTCATGTCGGC 3 86 1 CGCGACGTGG 0.989131 -53 CGACGTTGGTCATGTCGGCAGTCGTGTCCGA 3 98 1 CATGTCGCAG 0.987926 -41 ******* *** Masking position 7 Map Score: 34.979 Number of sites scoring better than the average of aligned sites = 22578 Number in coding regions = 21168 Number in noncoding regions = 1410 Number of orfs with sites within 600 bp upstream = 844 Fraction of orfs with sites within 600 bp upstream = 0.135561 Motif number 2 GCCGACGGGCCGTGTCGACGGCGTGGTGTCAGCC 1 38 1 CGTTCCGCGT 0.941076 -120 CACTTCGGCGCGCACCCACACGGCAACAAAGCAG 1 88 0 CGCCCCCGGC 0.952677 -70 TGGCACGTTACGCGCTGCTCGCACTTCGGCGCGC 1 109 0 CGCCTTGCAC 0.972758 -49 CAGCGCGTAACGTGCCAGTAGCACGTCGGCAGGA 1 126 1 CGTCCTGCAC 0.98876 -32 CGCATCCTTCCTGCCGACGTGCTA 1 144 0 CGCTCTCTGC 0.974469 -14 CGCAAACAACCGCCCGGTTAGCGCGGCAACACGA 2 31 0 CGCCGTGCGC 0.997783 -195 ACGGTGACCTCGCGCGTTTGCCGCAAACAACCGC 2 52 0 CGCCGTCCGC 0.996356 -174 ACCGTTGGGTCACATTAGTCGCACGTACCGGGGG 2 81 1 CACTTTGCAC 0.575273 -145 TTGTGACTTACGTTTCCATAGCGTCAGATGTGAC 2 119 1 CGTTCTGCGT 0.976101 -107 CGACACCACAAGCATCATTTGCACCGTACGTCAC 2 148 0 AGCTCTGCAC 0.890975 -78 TGATGCTTGTGGTGTCGTTGGCGTTGACCTGCGC 2 165 1 GGTTCTGCGT 0.774018 -61 CTGCGCTGTCCCTCCGAGTTGAGCCCTAGGAGAT 2 193 1 CCTCGTGAGC 0.660996 -33 ATTCCGTCGACGCCGCGGTGGTGCCCGGCAAATC 3 20 0 CGCGCTGTGC 0.968466 -119 TATTCCAGGCCTCCTGGATTCCGTCGACGCCGCG 3 37 0 CTCTGTCCGT 0.692048 -102 GGCAGCGACGCGCCCGCGTTCAACTATTCCAGGC 3 61 0 CGCCGTCAAC 0.909588 -78 AACGCGGGCGCGTCGCTGCCCCGCGACGTTGGTC 3 75 1 CGTGCCCCGC 0.956301 -64 *** ** * **** Masking position 9 Map Score: 17.3571 Number of sites scoring better than the average of aligned sites = 25250 Number in coding regions = 23209 Number in noncoding regions = 2041 Number of orfs with sites within 600 bp upstream = 1009 Fraction of orfs with sites within 600 bp upstream = 0.162062 Motif number 3 CGCCGTCGACACGGCCCGTCGGCGGGCGAA 1 31 0 ACGGCCCGTC 0.986501 -127 TAGGCTGACACCACGCCGTCGACACGGCCC 1 44 0 CCACGCCGTC 0.894292 -114 TTACGCGCTGCTCGCACTTCGGCGCGCACC 1 106 0 CTCGCACTTC 0.787972 -52 CGACGTGCTACTGGCACGTTACGCGCTGCT 1 124 0 CTGGCACGTT 0.972641 -34 GCCGCGCTAACCGGGCGGTTGTTTGCGGCA 2 38 1 CCGGGCGGTT 0.961681 -188 CAACGGTGACCTCGCGCGTTTGCCGCAAAC 2 58 0 CTCGCGCGTT 0.948092 -168 CGCGAGGTCACCGTTGGGTCACATTAGTCG 2 72 1 CCGTTGGGTC 0.812185 -154 CAAACTGCCCCCGGTACGTGCGACTAATGT 2 92 0 CCGGTACGTG 0.954877 -134 CATCATTTGCACCGTACGTCACATCTGACG 2 140 0 ACCGTACGTC 0.936738 -86 TCGGAGGGACAGCGCAGGTCAACGCCAACG 2 180 0 AGCGCAGGTC 0.791446 -46 CCGGGCACCACCGCGGCGTCGACGGAATCC 3 26 1 CCGCGGCGTC 0.991254 -113 TAGTTGAACGCGGGCGCGTCGCTGCCCCGC 3 69 1 CGGGCGCGTC 0.992302 -70 CGTCGCTGCCCCGCGACGTTGGTCATGTCG 3 85 1 CCGCGACGTT 0.971215 -54 ********** Masking position 9 Map Score: 13.8731 Number of sites scoring better than the average of aligned sites = 20658 Number in coding regions = 19044 Number in noncoding regions = 1614 Number of orfs with sites within 600 bp upstream = 958 Fraction of orfs with sites within 600 bp upstream = 0.153871 Motif number 4 CACGCCGTCGACACGGCCCGTCGGCGGGCG 1 33 0 ACACGGCCCG 0.969806 -125 CGGCAACAAAGCAGGACAAGCGTACTGCTA 1 72 0 GCAGGACAAG 0.956047 -86 GCGCGCACCCACACGGCAACAAAGCAGGAC 1 85 0 ACACGGCAAC 0.936878 -73 CGTGCTACTGGCACGTTACGCGCTGCTCGC 1 121 0 GCACGTTACG 0.903759 -37 TAGCGCGGCAACACGAGAAGAGATAGATGT 2 17 0 ACACGAGAAG 0.885431 -209 GCAAACAACCGCCCGGTTAGCGCGGCAACA 2 34 0 GCCCGGTTAG 0.867551 -192 CACAAACTGCCCCCGGTACGTGCGACTAAT 2 94 0 CCCCGGTACG 0.940695 -132 AGCATCATTTGCACCGTACGTCACATCTGA 2 142 0 GCACCGTACG 0.966876 -84 AACGCCAACGACACCACAAGCATCATTTGC 2 160 0 ACACCACAAG 0.941889 -66 ACTCGGAGGGACAGCGCAGGTCAACGCCAA 2 182 0 ACAGCGCAGG 0.824824 -44 CCGCGGTGGTGCCCGGCAAATCACACCTGG 3 12 0 GCCCGGCAAA 0.917051 -127 CCACAGCTCAATCGGACACGACTGCCGACA 3 110 0 ATCGGACACG 0.562159 -29 ********** Masking position 2 Map Score: 7.53309 Number of sites scoring better than the average of aligned sites = 13969 Number in coding regions = 12665 Number in noncoding regions = 1304 Number of orfs with sites within 600 bp upstream = 870 Fraction of orfs with sites within 600 bp upstream = 0.139737 Motif number 5 GCGAACCAAATCCCTGGGAGTTGAT 1 6 0 TCCCTGGGAG 0.985292 -152 GATTTGGTTCGCCCGCCGACGGGCCGTGTC 1 24 1 GCCCGCCGAC 0.985381 -134 GTCACAAACTGCCCCCGGTACGTGCGACTA 2 96 0 GCCCCCGGTA 0.909264 -130 ACCTGCGCTGTCCCTCCGAGTTGAGCCCTA 2 191 1 TCCCTCCGAG 0.991073 -35 TCCGAGTTGAGCCCTAGGAGATCTGAGTCG 2 205 1 GCCCTAGGAG 0.983561 -21 GCGCGTCGCTGCCCCGCGACGTTGGTCATG 3 82 1 GCCCCGCGAC 0.985069 -57 ********** Masking position 4 Map Score: 7.01281 Number of sites scoring better than the average of aligned sites = 1155 Number in coding regions = 1044 Number in noncoding regions = 111 Number of orfs with sites within 600 bp upstream = 102 Fraction of orfs with sites within 600 bp upstream = 0.0163829 Motif number 6 CCAGCCACATCTATCTCTTCTCGTG 2 6 1 CACATCTATC 0.982268 -220 ACCGTTGGGTCACATTAGTCGCACGTACCG 2 81 1 CACATTAGTC 0.956474 -145 CACCGTACGTCACATCTGACGCTATGGAAA 2 131 0 CACATCTGAC 0.991922 -95 CCCGGCAAATCACACCTGGC 3 1 0 CACACCTGGC 0.990746 -138 ********** Masking position 4 Map Score: 1.78544 Number of sites scoring better than the average of aligned sites = 111 Number in coding regions = 89 Number in noncoding regions = 22 Number of orfs with sites within 600 bp upstream = 28 Fraction of orfs with sites within 600 bp upstream = 0.00449727 Motif number 7 ********** No masking Map Score: -9.78117e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -9.78117e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: -9.78117e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0