AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i300_mixed15_mtub_reg_300.orf -a/home/amcguire/alignace/lib/ORF_mtub.txt -z/skink1/amcguire/genomes/mtub.fna -g0.66 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.66 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 dxs 143 dxs #2 idsA 22 idsA Motif number 1 GCCGGGAAGCCTGGTCGGCGACTCATTGTC 1 31 0 CTGGTCGGCG 0.999093 -113 GCCGACCAGGCTTCCCGGCGCGCCGGCCAC 1 42 1 CTTCCCGGCG 0.992751 -102 GATAGCGTCGGTGGCCGGCGCGCCGGGAAG 1 52 0 GTGGCCGGCG 0.997987 -92 GCTATCAAAGTGGTTCGGCCCTTTTGATCG 1 76 1 TGGTTCGGCC 0.98037 -68 TTCGGCCCTTTTGATCGGCGGCCGCATGCT 1 89 1 TTGATCGGCG 0.996188 -55 CGGCGGCCGCATGCTGGGCCAATGGGGGGG 1 104 1 ATGCTGGGCC 0.979765 -40 ********** Masking position 7 Map Score: 10.3388 Number of sites scoring better than the average of aligned sites = 8370 Number in coding regions = 7902 Number in noncoding regions = 468 Number of orfs with sites within 600 bp upstream = 416 Fraction of orfs with sites within 600 bp upstream = 0.0668166 Motif number 2 ATCGAACTCCGGAGTTGGATGA 1 2 1 TCGAACCCGG 0.986012 -142 AGCCTGGTCGGCGACTCATTGTCATCCAACT 1 23 0 GCGACTATTG 0.923588 -121 CCGGCGCGCCGGGAAGCCTGGTCGGCGACTC 1 37 0 GGGAAGCTGG 0.986086 -107 TTTGATAGCGTCGGTGGCCGGCGCGCCGGGA 1 54 0 TCGGTGCCGG 0.767362 -90 CTTTTGATCGGCGGCCGCATGCTGGGCCAAT 1 96 1 GCGGCCCATG 0.978872 -48 GGCCGCATGCTGGGCCAATGGGGGGGTTGCT 1 108 1 TGGGCCATGG 0.946454 -36 GGGGGTTGCTGCGTACACTAGCGAA 1 129 1 GCGTACCTAG 0.975218 -15 GAGCGAATGCTAGATTCACGCA 2 3 1 GCGAATCTAG 0.977659 -20 ****** **** Masking position 3 Map Score: 5.73942 Number of sites scoring better than the average of aligned sites = 16744 Number in coding regions = 15513 Number in noncoding regions = 1231 Number of orfs with sites within 600 bp upstream = 803 Fraction of orfs with sites within 600 bp upstream = 0.128975 Motif number 3 CACCGACGCTATCAAAGTGGTTCGGCCCTT 1 69 1 ATCAAAGTGG 0.993053 -75 GCGGCCGCCGATCAAAAGGGCCGAACCACT 1 84 0 ATCAAAAGGG 0.992991 -60 CGCATGCTGGGCCAATGGGGGGGTTGCTGC 1 111 1 GCCAATGGGG 0.981926 -33 ********** Masking position 5 Map Score: 1.32967 Number of sites scoring better than the average of aligned sites = 57 Number in coding regions = 49 Number in noncoding regions = 8 Number of orfs with sites within 600 bp upstream = 9 Fraction of orfs with sites within 600 bp upstream = 0.00144555 Motif number 4 ********** No masking Map Score: -2.03625e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -2.03625e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -2.03625e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0