AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i323_mixed8_mtub_reg_100.orf -a/home/amcguire/alignace/lib/ORF_mtub.txt -z/skink1/amcguire/genomes/mtub.fna -g0.66 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.66 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 mutA 190 mutA Motif number 1 ACATGAATAACTCGTTTCCCCAGGCTGGCG 1 33 1 CTCGTTTCCC 0.968065 -158 TTTCCCCAGGCTGGCGTTTCGTCACACTCC 1 47 1 CTGGCGTTTC 0.949024 -144 ACACTCCGGCCGCGATTGCCGCACCTGGGC 1 70 1 CGCGATTGCC 0.983281 -121 TTGCCGCACCTGGGCGTCTATATGGGCGTC 1 85 1 TGGGCGTCTA 0.925405 -106 GGCGTCTATATGGGCGTCCCGATCAACTAG 1 97 1 TGGGCGTCCC 0.993046 -94 GGGCTTGCTTCGGGATTGTCACTTAACTAA 1 132 0 CGGGATTGTC 0.984899 -59 CGATGTTGCTTGGGCTTGCTTCGGGATTGT 1 143 0 TGGGCTTGCT 0.961257 -48 CGACTGCTCCTGTTTTCCCAGCAATTAGC 1 172 0 CTGTTTTCCC 0.905375 -19 ********** Masking position 7 Map Score: 8.37103 Number of sites scoring better than the average of aligned sites = 9600 Number in coding regions = 8822 Number in noncoding regions = 778 Number of orfs with sites within 600 bp upstream = 598 Fraction of orfs with sites within 600 bp upstream = 0.0960488 Motif number 2 TTCATGTTGACCCCGTACGCTCCGAAGAC 1 10 0 CCCCGTACGC 0.97415 -181 AACTCGTTTCCCCAGGCTGGCGTTTCGTCA 1 41 1 CCCAGGCTGG 0.989998 -150 TTTCGTCACACTCCGGCCGCGATTGCCGCA 1 63 1 CTCCGGCCGC 0.975595 -128 CCATATAGACGCCCAGGTGCGGCAATCGCG 1 80 0 GCCCAGGTGC 0.963487 -111 TGATCGGGACGCCCATATAGACGCCCAGGT 1 92 0 GCCCATATAG 0.832079 -99 ATATGGGCGTCCCGATCAACTAGCCTTATT 1 104 1 CCCGATCAAC 0.957476 -87 AGTGACAATCCCGAAGCAAGCCCAAGCAAC 1 139 1 CCGAAGCAAG 0.913271 -52 CCGAAGCAAGCCCAAGCAACATCGCTAATT 1 149 1 CCCAAGCAAC 0.990444 -42 ********** Masking position 2 Map Score: 4.05117 Number of sites scoring better than the average of aligned sites = 23925 Number in coding regions = 22209 Number in noncoding regions = 1716 Number of orfs with sites within 600 bp upstream = 1002 Fraction of orfs with sites within 600 bp upstream = 0.160938 Motif number 3 ********** No masking Map Score: -2.32047e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -2.32047e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -2.32047e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0