AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i070_Threonine_Biosynthesis_pyro_reg_300.orf -o070_pyro_300.ace -a/home/amcguire/genomes/ORF_pyro.txt -z/home/amcguire/genomes/pyro.fna -g0.42 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.42 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RPH00272 300 Pyrococcus_OT3 #2 RPH00072 223 Pyrococcus_OT3 Motif number 1 ACATCTCCTGAATAAGGAGGAACGATGAGTTT 1 92 0 AAAAGGGGAA 0.952829 -209 ACATAGCACTTTAAAGGAGGATAGTAGGTTGC 1 132 1 TTAAGGGGAT 0.988068 -169 ATTTCCAAGAATGAAGTAGGAAGAAGGGTGAT 1 173 1 ATAAGTGGAA 0.984896 -128 TTTGGGAGTTTTGAAGTTGGGACGGGTAATTG 1 251 1 TTAAGTGGGA 0.97517 -50 CCAAGAAAAGTTAATGGAGGGTGCAAA 1 284 1 TTATGGGGGT 0.864517 -17 AATTGAAAATTTAAAAGTGGATAAGCTTTATT 2 45 0 TTAAAGGGAT 0.964428 -179 ATATTCTGAGATCAAATTGAAAATTTAAAAGT 2 59 0 ATAAATGAAA 0.800498 -165 TTTTAATAACATAAAATTGAAATAAAGAATTT 2 103 0 ATAAATGAAA 0.807819 -121 AGCTTATGAATTTAAGGGGGAAG 2 211 1 TTAAGGGGAA 0.993704 -13 ** **** **** Masking position 4 Map Score: 8.54393 Number of sites scoring better than the average of aligned sites = 704 Number in coding regions = 648 Number in noncoding regions = 56 Number of orfs with sites within 600 bp upstream = 61 Fraction of orfs with sites within 600 bp upstream = 0.00979762 Motif number 2 GGTTCGCTCTAGAAGGAAAGAAAAATTCCT 1 60 1 AGAAGGAAAG 0.975671 -241 CTCCTGAATAAGGAGGAACGATGAGTTTCC 1 90 0 AGGAGGAACG 0.985773 -211 AGGAGATGTTATGAAGAACATAGCACTTTA 1 115 1 ATGAAGAACA 0.820212 -186 AGCACTTTAAAGGAGGATAGTAGGTTGCTA 1 136 1 AGGAGGATAG 0.950713 -165 AGAATGAAGTAGGAAGAAGGGTGATTTAGG 1 180 1 AGGAAGAAGG 0.974627 -121 GTGCGAAAATATAAATAAAGCTTATCCACT 2 32 1 ATAAATAAAG 0.803944 -192 AACATAAAATTGAAATAAAGAATTTCTCAA 2 98 0 TGAAATAAAG 0.766506 -126 AATTCCTATTAGGAATAAAACAATTTGAGA 2 139 0 AGGAATAAAA 0.954179 -85 CATATTTTTTAGGATTAAAAATTCCTATTA 2 158 0 AGGATTAAAA 0.837066 -66 ********** Masking position 4 Map Score: 6.3076 Number of sites scoring better than the average of aligned sites = 1541 Number in coding regions = 1413 Number in noncoding regions = 128 Number of orfs with sites within 600 bp upstream = 121 Fraction of orfs with sites within 600 bp upstream = 0.0194346 Motif number 3 ATGAGTTTCCAGGAATTTTTCTTTCCTTCTAG 1 68 0 AGGAATTTCT 0.920181 -233 GAATTTCTCAAAAATTGTATATTCTGAGATCA 2 77 0 AAAATTTTAT 0.8075 -147 AATTGAAATAAAGAATTTCTCAAAAATTGTAT 2 89 0 AAGAATTTCA 0.982231 -135 TATGTTATTAAAAATTATCTCAAATTGTTTTA 2 122 1 AAAATTTTCA 0.952145 -102 TATTCCTAATAGGAATTTTTAATCCTAAAAAA 2 152 1 AGGAATTTAA 0.947318 -72 TTTAATCCTAAAAAATATGTCAAAAAATATAT 2 169 1 AAAAATTTCA 0.977556 -55 AAATATGTCAAAAAATATATAAAAATCGTGAG 2 181 1 AAAAATTTAA 0.956742 -43 ****** * *** Masking position 4 Map Score: 4.83779 Number of sites scoring better than the average of aligned sites = 109 Number in coding regions = 83 Number in noncoding regions = 26 Number of orfs with sites within 600 bp upstream = 33 Fraction of orfs with sites within 600 bp upstream = 0.00530035 Motif number 4 TATACTAAGGTTCGCTCTAGAAGGAAAGAA 1 52 1 TTCGCTCTAG 0.960065 -249 GAAGGGTGATTTAGGACTAGTGGTACTTGT 1 195 1 TTAGGACTAG 0.979213 -106 TATTTATATTTTCGCACTAGTTAGGTTCGG 2 19 0 TTCGCACTAG 0.987038 -205 AAAATTCCTATTAGGAATAAAACAATTTGA 2 141 0 TTAGGAATAA 0.916995 -83 GACATATTTTTTAGGATTAAAAATTCCTAT 2 160 0 TTAGGATTAA 0.916995 -64 ********** Masking position 8 Map Score: 2.93551 Number of sites scoring better than the average of aligned sites = 44 Number in coding regions = 40 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 5 GCTAGTTCCTGATTTCCAAGAATGAAGTAG 1 162 1 GATTTCCAAG 0.877414 -139 TTTCATGACCTTTCTCCAAGACAAGTACCA 1 215 0 TTTCTCCAAG 0.960179 -86 TTTTCAATTTGATCTCAGAATATACAATTT 2 68 1 GATCTCAGAA 0.938504 -156 AAATAAAGAATTTCTCAAAAATTGTATATT 2 86 0 TTTCTCAAAA 0.963724 -138 TATTAAAAATTATCTCAAATTGTTTTATTC 2 127 1 TATCTCAAAT 0.952208 -97 TCCTAAAAAATATGTCAAAAAATATATAAA 2 174 1 TATGTCAAAA 0.934337 -50 ********** Masking position 5 Map Score: 0.571102 Number of sites scoring better than the average of aligned sites = 221 Number in coding regions = 204 Number in noncoding regions = 17 Number of orfs with sites within 600 bp upstream = 19 Fraction of orfs with sites within 600 bp upstream = 0.00305172 Motif number 6 ********** No masking Map Score: -9.07063e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -9.07063e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -9.07063e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0