AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i077_Lipopolysaccharide_Biosynthesis_2__pyro_reg_100.orf -o077_pyro_100.ace -a/home/amcguire/genomes/ORF_pyro.txt -z/home/amcguire/genomes/pyro.fna -g0.42 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.42 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RPH00655 109 Pyrococcus_OT3 Motif number 1 CAAAAACTTCTTAATATCCTC 1 2 0 TTAATATCCT 0.924531 -108 CGCTTTTAAGTCAAAAACTTCTTAATATCC 1 13 0 TCAAAAACTT 0.993917 -97 AGTTTTTGACTTAAAAGCGTTAGTACTAAG 1 24 1 TTAAAAGCGT 0.975609 -86 TACAGCAATTTTAAAAAGCTAAGTATTTCA 1 65 1 TTAAAAAGCT 0.978907 -45 AAAAATTTGATGAAATACTTAGCTTTTTAA 1 75 0 TGAAATACTT 0.95634 -35 TGCACCTCGCTCAAAAATTTGATGAAATAC 1 87 0 TCAAAAATTT 0.969049 -23 ********** Masking position 4 Map Score: 5.50712 Number of sites scoring better than the average of aligned sites = 562 Number in coding regions = 448 Number in noncoding regions = 114 Number of orfs with sites within 600 bp upstream = 133 Fraction of orfs with sites within 600 bp upstream = 0.021362 Motif number 2 CTAACGCTTTTAAGTCAAAAACTTCTTAAT 1 17 0 TAAGTCAAAA 0.9594 -93 GCGTTAGTACTAAGAGAGCAGATAATACAG 1 40 1 TAAGAGAGCA 0.989642 -70 AGAGAGCAGATAATACAGCAATTTTAAAAA 1 52 1 TAATACAGCA 0.993811 -58 AAAAGCTAAGTATTTCATCAAATTTTTGAG 1 78 1 TATTTCATCA 0.958101 -32 ********** Masking position 7 Map Score: 1.89005 Number of sites scoring better than the average of aligned sites = 168 Number in coding regions = 152 Number in noncoding regions = 16 Number of orfs with sites within 600 bp upstream = 19 Fraction of orfs with sites within 600 bp upstream = 0.00305172 Motif number 3 ********** No masking Map Score: 1.16119e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 1.16119e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.16119e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0