AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i271_hypothetical16_pyro_reg_100.orf -o271_pyro_100.ace -a/home/amcguire/genomes/ORF_pyro.txt -z/home/amcguire/genomes/pyro.fna -g0.42 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.42 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RPH00534 20 Pyrococcus_OT3 #2 RPH00533 119 Pyrococcus_OT3 Motif number 1 ATTAGTAGGAGGTATTGAAA 1 1 1 ATTAGTAGGA 0.964661 -20 GTTGTATATAGGTAGTTGGAAGTTTAACTC 2 24 0 GGTAGTTGGA 0.998027 -96 AAAATGGAGGGGAAGTTGTATATAGGTAGT 2 38 0 GGAAGTTGTA 0.9746 -82 CCATCTCCTGAGTTGCTGGATCCCACCTGG 2 83 0 AGTTGCTGGA 0.988171 -37 CCAGCAACTCAGGAGATGGAAAAAGTGAAT 2 94 1 AGGAGATGGA 0.990893 -26 ********** Masking position 10 Map Score: 6.00928 Number of sites scoring better than the average of aligned sites = 413 Number in coding regions = 388 Number in noncoding regions = 25 Number of orfs with sites within 600 bp upstream = 21 Fraction of orfs with sites within 600 bp upstream = 0.00337295 Motif number 2 TTTCAATACCTCCTACTAAT 1 5 0 TACCTCCTAC 0.97118 -16 TTAACTCTGGTAACCCCTCA 2 1 0 TAACCCCTCA 0.989049 -119 CTATATACAACTTCCCCTCCATTTTAGTTT 2 43 1 CTTCCCCTCC 0.987782 -77 TCACTTTTTCCATCTCCTGAGTTGCTGGAT 2 92 0 CATCTCCTGA 0.988392 -28 GTATCTATTCACTTTTTCCAT 2 109 0 TATCTATTCA 0.885889 -11 ********** Masking position 8 Map Score: 1.39634 Number of sites scoring better than the average of aligned sites = 1654 Number in coding regions = 1511 Number in noncoding regions = 143 Number of orfs with sites within 600 bp upstream = 152 Fraction of orfs with sites within 600 bp upstream = 0.0244137 Motif number 3 AGTTAAACTTCCAACTACCTATATACAACT 2 25 1 CCAACTACCT 0.995155 -95 CTACCTATATACAACTTCCCCTCCATTTTA 2 39 1 ACAACTTCCC 0.991486 -81 CAGGTGGGATCCAGCAACTCAGGAGATGGA 2 84 1 CCAGCAACTC 0.98989 -36 ********** Masking position 3 Map Score: 0.337967 Number of sites scoring better than the average of aligned sites = 146 Number in coding regions = 137 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 4 ********** No masking Map Score: 2.37484e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 2.37484e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 2.37484e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0