AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i200_excinuclease_mthe_reg_300.orf -o200_mthe_300.ace -a/home/amcguire/genomes/ORF_mthe.txt -z/home/amcguire/genomes/mthe.fna -g0.50 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTH00601 195 M.thermo Motif number 1 GTGGGATTATATTTCAGGGTCAACTTATAT 1 42 1 ATTTCAGGGT 0.976131 -154 ATATATACCTTTGCCAGGATACATAAAGTT 1 68 1 TTGCCAGGAT 0.982939 -128 AGTCTCATATCTGACAGGGTATCCCACGTG 1 106 1 CTGACAGGGT 0.993994 -90 TGGGGGTATCATCACAGGATTATGGAACAC 1 133 0 ATCACAGGAT 0.981812 -63 TTAAACATAAATCAGAGGATGGTAATGATA 1 174 1 ATCAGAGGAT 0.972472 -22 ********** Masking position 6 Map Score: 5.5611 Number of sites scoring better than the average of aligned sites = 345 Number in coding regions = 321 Number in noncoding regions = 24 Number of orfs with sites within 600 bp upstream = 20 Fraction of orfs with sites within 600 bp upstream = 0.00321234 Motif number 2 CCACAATAGAATGAGGTTCTTATTTTAAGT 1 16 0 ATGAGGTTCT 0.976245 -180 TCATTCTATTGTGGGATTATATTTCAGGGT 1 32 1 GTGGGATTAT 0.988385 -164 CCTGTCAGATATGAGACTCCAGACTCAACT 1 94 0 ATGAGACTCC 0.96014 -102 TATGGAACACGTGGGATACCCTGTCAGATA 1 113 0 GTGGGATACC 0.984468 -83 AACAAGTTCAGTGGGGGTATCATCACAGGA 1 144 0 GTGGGGGTAT 0.981915 -52 ********** Masking position 2 Map Score: 2.70592 Number of sites scoring better than the average of aligned sites = 532 Number in coding regions = 496 Number in noncoding regions = 36 Number of orfs with sites within 600 bp upstream = 25 Fraction of orfs with sites within 600 bp upstream = 0.00401542 Motif number 3 GAATGAGGTTCTTATTTTAAGTGATTT 1 8 0 CTTATTTTAA 0.842408 -188 CTATTGTGGGATTATATTTCAGGGTCAACT 1 37 1 ATTATATTTC 0.947294 -159 TCAGGGTCAACTTATATATACCTTTGCCAG 1 55 1 CTTATATATA 0.921341 -141 CAGACTCAACTTTATGTATCCTGGCAAAGG 1 75 0 TTTATGTATC 0.974049 -121 TCATCACAGGATTATGGAACACGTGGGATA 1 125 0 ATTATGGAAC 0.88828 -71 CATCCTCTGATTTATGTTTAAAACAAGTTC 1 165 0 TTTATGTTTA 0.962048 -31 ********** Masking position 5 Map Score: 1.9134 Number of sites scoring better than the average of aligned sites = 139 Number in coding regions = 100 Number in noncoding regions = 39 Number of orfs with sites within 600 bp upstream = 40 Fraction of orfs with sites within 600 bp upstream = 0.00642467 Motif number 4 ********** No masking Map Score: -3.30951e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -3.30951e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -3.30951e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0