AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i250_fts_cell_wall_mthe_reg_100.orf -o250_mthe_100.ace -a/home/amcguire/genomes/ORF_mthe.txt -z/home/amcguire/genomes/mthe.fna -g0.50 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTH01592 235 M.thermo Motif number 1 ATCTGGGCGGGACCCCCCATCATGACATGTTA 1 19 0 GCCCCCCATA 0.978058 -217 TGGGGGGTCCCGCCCAGATTCATGATATTCAT 1 32 1 CCCCAGATTA 0.990646 -204 TGGTCCACGTGGCCATGAATATCATGAATCTG 1 46 0 GCCATGAATT 0.801284 -190 TGGCCACGTGGACCATCAATAATTTTATTTTG 1 63 1 GCCATCAATA 0.97341 -173 TTTTATTTTGCCCCAACCTTGAGCCGGTATTT 1 85 1 CCCAACCTTA 0.974449 -151 ATGGAGCCATGGCTCACATTCAAAATTAAAAA 1 137 0 GCTCACATTA 0.969043 -99 GGCTCCATCGGTGCCAGATTAACCGTTGCTTT 1 161 1 GGCCAGATTA 0.966121 -75 TTACTACCCCCACACTTATCTATGAAAT 1 218 0 CCCCACACTA 0.98728 -18 * ******** * Masking position 10 Map Score: 5.08427 Number of sites scoring better than the average of aligned sites = 751 Number in coding regions = 701 Number in noncoding regions = 50 Number of orfs with sites within 600 bp upstream = 53 Fraction of orfs with sites within 600 bp upstream = 0.00851269 Motif number 2 AAGGTTGGGGCAAAATAAAATTATTGATGG 1 75 0 CAAAATAAAA 0.987068 -161 GGCTCACATTCAAAATTAAAAATCAATTTC 1 129 0 CAAAATTAAA 0.987005 -107 TGTGATAAGACATATTTAAAAGCAACGGTT 1 181 0 CATATTTAAA 0.9448 -55 TATGTCTTATCACAATAACATATTTCATAG 1 197 1 CACAATAACA 0.974118 -39 ********** Masking position 6 Map Score: 2.56608 Number of sites scoring better than the average of aligned sites = 42 Number in coding regions = 24 Number in noncoding regions = 18 Number of orfs with sites within 600 bp upstream = 16 Fraction of orfs with sites within 600 bp upstream = 0.00256987 Motif number 3 TGATGGTCCACGTGGCCATGAATATCATGA 1 51 0 CGTGGCCATG 0.772731 -185 GGCTCAAGGTTGGGGCAAAATAAAATTATT 1 80 0 TGGGGCAAAA 0.951645 -156 CTGAAAATACCGGCTCAAGGTTGGGGCAAA 1 91 0 CGGCTCAAGG 0.967047 -145 CTGGCACCGATGGAGCCATGGCTCACATTC 1 148 0 TGGAGCCATG 0.984671 -88 ATGGCTCCATCGGTGCCAGATTAACCGTTG 1 159 1 CGGTGCCAGA 0.986055 -77 ********** Masking position 8 Map Score: 1.16391 Number of sites scoring better than the average of aligned sites = 647 Number in coding regions = 615 Number in noncoding regions = 32 Number of orfs with sites within 600 bp upstream = 22 Fraction of orfs with sites within 600 bp upstream = 0.00353357 Motif number 4 CTTTTTCATAACATGTCATG 1 1 1 CTTTTTCATA 0.934737 -235 CTTTTTCATAACATGTCATGATGGGGGGTC 1 11 1 ACATGTCATG 0.970445 -225 TTGCTTTTAAATATGTCTTATCACAATAAC 1 186 1 ATATGTCTTA 0.974206 -50 TCACAATAACATATTTCATAGATAAGTGTG 1 206 1 ATATTTCATA 0.98405 -30 ********** Masking position 6 Map Score: 0.231721 Number of sites scoring better than the average of aligned sites = 41 Number in coding regions = 33 Number in noncoding regions = 8 Number of orfs with sites within 600 bp upstream = 8 Fraction of orfs with sites within 600 bp upstream = 0.00128493 Motif number 5 ********** No masking Map Score: 3.64809e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 3.64809e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 3.64809e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0