AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i299_mixed14_mthe_reg_300.orf -o299_mthe_300.ace -a/home/amcguire/genomes/ORF_mthe.txt -z/home/amcguire/genomes/mthe.fna -g0.50 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTH02082 137 M.thermo Motif number 1 GGTCCTTTATATATAGGTCCATATAAGAGA 1 33 0 ATATAGGTCC 0.978388 -105 AATTAATTATATGGGGGTCCTTTATATATA 1 48 0 ATGGGGGTCC 0.999096 -90 CAGTCAGCCACTGGAGGTCCCGCTGTAGCG 1 109 0 CTGGAGGTCC 0.999096 -29 CAGTGGCTGACTGGGGGACTCA 1 126 1 CTGGGGGACT 0.994163 -12 ********** Masking position 2 Map Score: 7.50713 Number of sites scoring better than the average of aligned sites = 364 Number in coding regions = 347 Number in noncoding regions = 17 Number of orfs with sites within 600 bp upstream = 13 Fraction of orfs with sites within 600 bp upstream = 0.00208802 Motif number 2 CCTATATATAAAGGACCCCCATATAATTAA 1 46 1 AAGGACCCCC 0.990451 -92 ATCGCTACAGCGGGACCTCCAGTGGCTGAC 1 107 1 CGGGACCTCC 0.958186 -31 TGAGTCCCCCAGTCAGCCAC 1 128 0 TGAGTCCCCC 0.955511 -10 ********** Masking position 6 Map Score: 2.38361 Number of sites scoring better than the average of aligned sites = 189 Number in coding regions = 175 Number in noncoding regions = 14 Number of orfs with sites within 600 bp upstream = 16 Fraction of orfs with sites within 600 bp upstream = 0.00256987 Motif number 3 ********** No masking Map Score: 2.15595e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 2.15595e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 2.15595e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0