AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i332_not_clear7_mthe_reg_300.orf -o332_mthe_300.ace -a/home/amcguire/genomes/ORF_mthe.txt -z/home/amcguire/genomes/mthe.fna -g0.50 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTH01043 246 M.thermo Motif number 1 TTCTCCTGGTGGGAGCTGGAGCTCAGGAGC 1 51 1 GGGAGCTGGA 0.992474 -196 ACCTGAATCAGGCTCCTGAGCTCCAGCTCC 1 62 0 GGCTCCTGAG 0.981698 -185 CGCGGCTTCAGGGACCTGAATCAGGCTCCT 1 75 0 GGGACCTGAA 0.999056 -172 GCCAGTCATGGGGCCCTGAAGAGGTGATTA 1 115 0 GGGCCCTGAA 0.998394 -132 ATCAGTAAATCCGACCTGAAAATCAGCCAG 1 140 0 CCGACCTGAA 0.988393 -107 ********** Masking position 7 Map Score: 7.93027 Number of sites scoring better than the average of aligned sites = 357 Number in coding regions = 339 Number in noncoding regions = 18 Number of orfs with sites within 600 bp upstream = 19 Fraction of orfs with sites within 600 bp upstream = 0.00305172 Motif number 2 GCTCCAGCTCCCACCAGGAGAAAACCCAAAG 1 42 0 CCACCAGGAA 0.95968 -205 AAGCCGCGATCCATCAGTTAATCACCTCTTC 1 97 1 CCATCAGTTA 0.990315 -150 TCAGTAAATCCGACCTGAAAATCAGCCAGTC 1 138 0 CGACCTGAAA 0.964982 -109 TCCCGGCCAGCCATCAGTAAATCCGACCTGA 1 151 0 CCATCAGTAA 0.993387 -96 AAAACCTCCAGATTAAAGTGGATTT 1 232 0 CCTCCAGATA 0.982813 -15 ********* * Masking position 11 Map Score: 4.69244 Number of sites scoring better than the average of aligned sites = 259 Number in coding regions = 234 Number in noncoding regions = 25 Number of orfs with sites within 600 bp upstream = 27 Fraction of orfs with sites within 600 bp upstream = 0.00433665 Motif number 3 GTGATTAACTGATGGATCGCGGCTTCAGGG 1 92 0 GATGGATCGC 0.993028 -155 TTCAGGGCCCCATGACTGGCTGATTTTCAG 1 125 1 CATGACTGGC 0.996036 -122 CGGATTTACTGATGGCTGGCCGGGACTCAT 1 157 1 GATGGCTGGC 0.9974 -90 AAAAGATTTACATGAGTCCCGGCCAGCCAT 1 168 0 CATGAGTCCC 0.980744 -79 ********** Masking position 7 Map Score: 3.33898 Number of sites scoring better than the average of aligned sites = 58 Number in coding regions = 52 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 4 GCTCCAGCTCCCACCAGGAGAAAACCCAAA 1 43 0 CCACCAGGAG 0.992567 -204 AAGCCGCGATCCATCAGTTAATCACCTCTT 1 97 1 CCATCAGTTA 0.992957 -150 TCCCGGCCAGCCATCAGTAAATCCGACCTG 1 152 0 CCATCAGTAA 0.995981 -95 ********** Masking position 6 Map Score: 1.87968 Number of sites scoring better than the average of aligned sites = 30 Number in coding regions = 26 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 5 ********** No masking Map Score: 2.79544e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 2.79544e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 2.79544e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0