AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i008_Uracil_Utilization_tpal_reg_100.orf -o008_tpal_100.ace -a/home/amcguire/alignace/lib/ORF_tpal.txt -z/skink1/amcguire/genomes/tpal.fna -g0.53 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.53 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTP00166 135 AE000520 #2 RTP00167 41 AE000520 #3 RTP00169 57 AE000520 Motif number 1 AAGTTTGAACGCAAGTCAGCT 1 2 0 GCAAGTCAGC 0.974427 -134 ACCGCTTTTGGCGAGGCGTTGTTTGCAATG 1 81 1 GCGAGGCGTT 0.98449 -55 GGCGTTGTTTGCAATGCTGCTAATGAGCGC 1 95 1 GCAATGCTGC 0.992961 -41 GGCGAGCAATGCGTCAAAGTGTTGT 2 6 1 GCAATGCGTC 0.998529 -36 AAGCGGTACCGTAATGCGTCCGTTAATGTC 3 22 0 GTAATGCGTC 0.992397 -36 ********** Masking position 4 Map Score: 7.14009 Number of sites scoring better than the average of aligned sites = 202 Number in coding regions = 185 Number in noncoding regions = 17 Number of orfs with sites within 600 bp upstream = 16 Fraction of orfs with sites within 600 bp upstream = 0.00256987 Motif number 2 AGCTGACTTGCGTTCAAACTTTCTGGGA 1 9 1 TGCGTTCAAA 0.974399 -127 TTTTTTAGAATGTGCTCGAGTTGAGTAGCA 1 51 1 TGTGCTCGAG 0.98598 -85 AAGAGGGTTATGCGCTCATTAGCAGCATTG 1 106 0 TGCGCTCATT 0.969517 -30 CATAACCCTCTTTGTCCGAGGT 1 124 1 TTTGTCCGAG 0.952275 -12 GGCGAGCAATGCGTCAAAGTGTTGTTGAT 2 10 1 TGCGTCAAAG 0.975157 -32 GGTACCGTAATGCGTCCGTTAATGTCGGTA 3 18 0 TGCGTCCGTT 0.989519 -40 ********** Masking position 1 Map Score: 5.14449 Number of sites scoring better than the average of aligned sites = 733 Number in coding regions = 695 Number in noncoding regions = 38 Number of orfs with sites within 600 bp upstream = 37 Fraction of orfs with sites within 600 bp upstream = 0.00594282 Motif number 3 CATTCTAAAAAAGCCGCTGCATATTCCCAG 1 33 0 AAGCCGCTGC 0.996965 -103 GCCTCGCCAAAAGCGGTTGCTACTCAACTC 1 68 0 AAGCGGTTGC 0.998612 -68 GACGACCACCAAGCGGTACCGTAATGCGTC 3 32 0 AAGCGGTACC 0.995511 -26 ********** Masking position 2 Map Score: 3.10382 Number of sites scoring better than the average of aligned sites = 21 Number in coding regions = 20 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 4 CCGTTAATGTCGGTACGGTACG 3 3 0 CGGTACGGTA 0.998609 -55 GACCACCAAGCGGTACCGTAATGCGTCCGT 3 29 0 CGGTACCGTA 0.998609 -29 ********** Masking position 5 Map Score: 1.61687 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 TAAAAAAGCCGCTGCATATTCCCAGAAAGTTTG 1 25 0 GCTGCAATCC 0.995632 -111 GCCAAAAGCGGTTGCTACTCAACTCGAGCACAT 1 60 0 GTTGCTCTAC 0.912035 -76 TGTTTGCAATGCTGCTAATGAGCGCATAACCCT 1 100 1 GCTGCTATAC 0.93379 -36 GCGTCAAAGTGTTGTTGATTCTCGCTGGTTT 2 21 1 GTTGTTATCC 0.989094 -21 ****** ** * * Masking position 9 Map Score: 1.28684 Number of sites scoring better than the average of aligned sites = 76 Number in coding regions = 70 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 6 TTTTTAGAATGTGCTCGAGTTGAGTAGCAAC 1 52 1 GTGTCGAGTT 0.980588 -84 AACCGCTTTTGGCGAGGCGTTGTTTGCAATG 1 80 1 GGCAGGCGTT 0.984582 -56 CGAGCAATGCGTCAAAGTGTTGTTGATTCTC 2 13 1 GTCAAGTGTT 0.988703 -29 CCGCTTGGTGGTCGTCGTGTTA 3 46 1 GTCTCGTGTT 0.995815 -12 *** ******* Masking position 10 Map Score: 0.227105 Number of sites scoring better than the average of aligned sites = 50 Number in coding regions = 45 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 7 ********** No masking Map Score: 3.08538e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 3.08538e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: 3.08538e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0