AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i119_Spermidine_putrescine_Transport_tpal_reg_100.orf -o119_tpal_100.ace -a/home/amcguire/alignace/lib/ORF_tpal.txt -z/skink1/amcguire/genomes/tpal.fna -g0.53 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.53 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTP00575 175 AE000520 Motif number 1 TCGCTGAAGCGCGGCGTATAGAAA 1 1 1 TGCAGCGCGG 0.965944 -175 CCTACCTATCACCCGTACCCGGGCGACAATCGCC 1 37 0 ACCACCGGGC 0.993785 -139 GCTATTGCTTACCCTCATGCGCGCGTTCACCGAA 1 87 0 ACCAGCGCGC 0.91413 -89 TGCTGCAAAAAAACACACGCGCGCGGCTATTGCT 1 112 0 AACAGCGCGC 0.995184 -64 GTGTGTTTTTTTGCAGCACCGTGCATACCGCCCC 1 128 1 TGCCCCGTGC 0.993129 -48 GCACCGTGCATACCGCCCCAGCGGACGTCGCTAA 1 143 1 TCCCCAGCGG 0.983393 -33 CCAGCGGACGTCGCTAAGCTGCGCCG 1 160 1 TGCACTGCGC 0.978364 -16 * ** * ****** Masking position 4 Map Score: 11.2355 Number of sites scoring better than the average of aligned sites = 744 Number in coding regions = 693 Number in noncoding regions = 51 Number of orfs with sites within 600 bp upstream = 46 Fraction of orfs with sites within 600 bp upstream = 0.00738837 Motif number 2 CCCCTTTCTATACGCCGCGCTTCAGCGA 1 9 0 TACGCCGCGC 0.994755 -167 CGGCGTATAGAAAGGGGCGATTGTCGCCCG 1 22 1 AAAGGGGCGA 0.932173 -154 CCTATCACCCGTACCCGGGCGACAATCGCC 1 37 0 GTACCCGGGC 0.982566 -139 AAGTTTCGGTGAACGCGCGCATGAGGGTAA 1 83 1 GAACGCGCGC 0.996494 -93 AGGGTAAGCAATAGCCGCGCGCGTGTGTTT 1 106 1 ATAGCCGCGC 0.997407 -70 TGCTGCAAAAAAACACACGCGCGCGGCTAT 1 116 0 AAACACACGC 0.9436 -60 CGGACGTCGCTAAGCTGCGCCG 1 164 1 TAAGCTGCGC 0.989632 -12 ********** Masking position 9 Map Score: 10.303 Number of sites scoring better than the average of aligned sites = 1262 Number in coding regions = 1184 Number in noncoding regions = 78 Number of orfs with sites within 600 bp upstream = 64 Fraction of orfs with sites within 600 bp upstream = 0.0102795 Motif number 3 ********** No masking Map Score: 2.15595e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 2.15595e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 2.15595e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0