AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i119_Spermidine_putrescine_Transport_tpal_reg_300.orf -o119_tpal_300.ace -a/home/amcguire/alignace/lib/ORF_tpal.txt -z/skink1/amcguire/genomes/tpal.fna -g0.53 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.53 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTP00575 175 AE000520 Motif number 1 TTTCTATACGCCGCGCTTCAGCGA 1 1 0 CCGCGCTGCA 0.964711 -175 GGCGATTGTCGCCCGGGTACGGGTGATAGGTAGG 1 37 1 GCCCGGTGGT 0.993851 -139 TTCGGTGAACGCGCGCATGAGGGTAAGCAATAGC 1 87 1 GCGCGCTGGT 0.911077 -89 AGCAATAGCCGCGCGCGTGTGTTTTTTTGCAGCA 1 112 1 GCGCGCTGTT 0.995379 -64 GGGGCGGTATGCACGGTGCTGCAAAAAAACACAC 1 128 0 GCACGGGGCA 0.9934 -48 TTAGCGACGTCCGCTGGGGCGGTATGCACGGTGC 1 143 0 CCGCTGGGGA 0.984001 -33 CGGCGCAGCTTAGCGACGTCCGCTGG 1 160 0 GCGCAGTGCA 0.977816 -16 ****** * ** * Masking position 4 Map Score: 11.2355 Number of sites scoring better than the average of aligned sites = 744 Number in coding regions = 693 Number in noncoding regions = 51 Number of orfs with sites within 600 bp upstream = 46 Fraction of orfs with sites within 600 bp upstream = 0.00738837 Motif number 2 TCGCCCCTTTCTATACGCCGCGCTTCAGCG 1 12 0 CTATACGCCG 0.965049 -164 ACCCGGGCGACAATCGCCCCTTTCTATACG 1 25 0 CAATCGCCCC 0.998327 -151 TGACACCTACCTATCACCCGTACCCGGGCG 1 46 0 CTATCACCCG 0.993278 -130 TGAGGGTAAGCAATAGCCGCGCGCGTGTGT 1 104 1 CAATAGCCGC 0.986884 -72 AGCACCGTGCATACCGCCCCAGCGGACGTC 1 142 1 ATACCGCCCC 0.986637 -34 ********** Masking position 3 Map Score: 4.23553 Number of sites scoring better than the average of aligned sites = 191 Number in coding regions = 175 Number in noncoding regions = 16 Number of orfs with sites within 600 bp upstream = 16 Fraction of orfs with sites within 600 bp upstream = 0.00256987 Motif number 3 TATACGCCGCGCTTCAGCGA 1 1 0 GCTTCAGCGA 0.996759 -175 GTTCACCGAAACTTCACCTAATGACACCTA 1 67 0 ACTTCACCTA 0.9632 -109 CTCATGCGCGCGTTCACCGAAACTTCACCT 1 78 0 CGTTCACCGA 0.987471 -98 CGTGCATACCGCCCCAGCGGACGTCGCTAA 1 147 1 GCCCCAGCGG 0.985179 -29 CGGCGCAGCTTAGCGACGTCCGCTGG 1 160 0 AGCTTAGCGA 0.965816 -16 ********** Masking position 6 Map Score: 2.73676 Number of sites scoring better than the average of aligned sites = 255 Number in coding regions = 235 Number in noncoding regions = 20 Number of orfs with sites within 600 bp upstream = 19 Fraction of orfs with sites within 600 bp upstream = 0.00305172 Motif number 4 ********** No masking Map Score: 2.15595e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 2.15595e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 2.15595e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0