AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i128_Transmembrane_Transport_2_tpal_reg_100.orf -o128_tpal_100.ace -a/home/amcguire/alignace/lib/ORF_tpal.txt -z/skink1/amcguire/genomes/tpal.fna -g0.53 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.53 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTP00008 129 AE000520 #2 RTP00605 80 AE000520 #3 RTP00606 87 AE000520 #4 RTP00607 300 AE000520 Motif number 1 GCGTATGTCGCTTACCGCGCGTATAGAAAC 1 55 0 CTTACCGCGC 0.900438 -75 CGCCGGTGTATGGCCAGCGCTTTCCTCTTT 1 82 1 TGGCCAGCGC 0.962073 -48 AGCCTGGTTTTAGGCTGCACACTTT 1 115 1 TAGGCTGCAC 0.908804 -15 GTCTCTCCAGAAGCCTGCGCATGTCAAGGA 2 18 0 AAGCCTGCGC 0.982394 -63 TGGAGAGACGCAACATGCGCTTGGAACACC 2 39 1 CAACATGCGC 0.903193 -42 TGGAACACCTCACGCTGCTCCCGCACATAC 2 60 1 CACGCTGCTC 0.868872 -21 ACCCGAATCGCGCACAGCGCCGCGACAATC 3 43 1 CGCACAGCGC 0.932185 -45 GCGGGGGCTGCAGACAGCGCGAGAGATTGT 3 67 0 CAGACAGCGC 0.992379 -21 GCGCTGTCTGCAGCCCCCGCC 3 77 1 CAGCCCCCGC 0.976125 -11 CACATCCTGCGCGACACCATCG 4 3 1 CATCCTGCGC 0.99717 -298 ATGCATTTCCCATACCGCACCCATAACTGA 4 34 1 CATACCGCAC 0.92808 -267 ATATGCGGCACCGCATGCACACTTCCTAGC 4 86 0 CCGCATGCAC 0.838113 -215 TGGATGAGTATCGCCTGCGCACGCGTACCT 4 194 0 TCGCCTGCGC 0.979739 -107 AGGCGATACTCATCCAGGGCGCGCAGCATG 4 208 1 CATCCAGGGC 0.938745 -93 GGGTAGAAGACATGCTGCGCGCCCTGGATG 4 218 0 CATGCTGCGC 0.992766 -83 ********** Masking position 10 Map Score: 25.0438 Number of sites scoring better than the average of aligned sites = 1939 Number in coding regions = 1813 Number in noncoding regions = 126 Number of orfs with sites within 600 bp upstream = 94 Fraction of orfs with sites within 600 bp upstream = 0.015098 Motif number 2 CGGCGTATGTCGCTTACCGCGCGTATAGAAA 1 56 0 CGCTTACGCG 0.96507 -74 GAAAGCGCTGGCCATACACCGGCGTATGTCG 1 75 0 GCCATACCCG 0.944043 -55 TACTTTCCTTGACATGCGCAGGCTTCTGGAG 2 13 1 GACATGCCAG 0.820714 -68 GTGTTCCAAGCGCATGTTGCGTCTCTCCAGA 2 37 0 CGCATGTGCG 0.927399 -44 CAGTAGAAAACACATACAGAGTAACAAAAGG 3 11 1 CACATACGAG 0.965694 -77 GCACCCGAATCGCGCACAGCGCCGCGACAAT 3 41 1 CGCGCACGCG 0.960283 -47 GGCGGGGGCTGCAGACAGCGCGAGAGATTG 3 68 0 TGCAGACGCG 0.866614 -20 CACATCCTGCGCGACACCATC 4 1 1 CACATCCGCG 0.918853 -300 GCATGCATTTCCCATACCGCACCCATAACTG 4 32 1 CCCATACGCA 0.918645 -269 CTAGGAAGTGTGCATGCGGTGCCGCATATAC 4 87 1 TGCATGCGTG 0.830074 -214 CATGCGGTGCCGCATATACCAACATAAGAAT 4 99 1 CGCATATCCA 0.698986 -202 CCCAAAGGTACGCGTGCGCAGGCGATACTCA 4 189 1 CGCGTGCCAG 0.954249 -112 GCAGGCGATACTCATCCAGGGCGCGCAGCAT 4 206 1 CTCATCCGGG 0.794424 -95 TCGGGTAGAAGACATGCTGCGCGCCCTGGAT 4 219 0 GACATGCGCG 0.975589 -82 TTTGGCAAAGCGCGTACGCGGAGTTCTATTT 4 274 0 CGCGTACCGG 0.956711 -27 ******* *** Masking position 3 Map Score: 17.4231 Number of sites scoring better than the average of aligned sites = 2057 Number in coding regions = 1904 Number in noncoding regions = 153 Number of orfs with sites within 600 bp upstream = 115 Fraction of orfs with sites within 600 bp upstream = 0.0184709 Motif number 3 AGCCTAAAACCAGGCTTCCAAAGAGGAAAGC 1 100 0 CAGCTTCCAA 0.979954 -30 GAGCAGCGTGAGGTGTTCCAAGCGCATGTTG 2 49 0 AGGGTTCCAA 0.984672 -32 AAAACACATACAGAGTAACAAAAGGCACCCG 3 17 1 CAGGTAACAA 0.890563 -71 GCACACTTCCTAGCGTTCCATTTGGTTATCT 4 69 0 TAGGTTCCAT 0.956328 -232 TCTTTTTTTTCGGCGTTCCAACTATTCTTAT 4 122 0 CGGGTTCCAA 0.997026 -179 AGCGCGTACGCGGAGTTCTATTTTACCGATA 4 266 0 CGGGTTCTAT 0.965276 -35 *** ******* Masking position 6 Map Score: 4.21653 Number of sites scoring better than the average of aligned sites = 54 Number in coding regions = 53 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 4 GAGGGAAAGTTCTTCTACCGTAAAATCT 1 9 0 TCTTCTACCG 0.987277 -121 TCTGTATGTGTTTTCTACTG 3 1 0 TTTTCTACTG 0.94719 -87 TTCCATTTGGTTATCTTCGGATCAGTTATG 4 55 0 TTATCTTCGG 0.886364 -246 CTGTTAATCTTTTTTTTCGGCGTTCCAACT 4 130 0 TTTTTTTCGG 0.947893 -171 TAACAGCCTCTTTATTTCCGCGCTCATTCC 4 154 1 TTTATTTCCG 0.878428 -147 GCGCAGCATGTCTTCTACCCGAAAGTCAGG 4 228 1 TCTTCTACCC 0.937177 -73 CGCGGAGTTCTATTTTACCGATATCCTGTG 4 259 0 TATTTTACCG 0.932316 -42 ********** Masking position 6 Map Score: 3.69769 Number of sites scoring better than the average of aligned sites = 191 Number in coding regions = 180 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 16 Fraction of orfs with sites within 600 bp upstream = 0.00256987 Motif number 5 ********** No masking Map Score: -9.28379e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -9.28379e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -9.28379e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0