AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i205_dna_mismatch_repair_tpal_reg_300.orf -o205_tpal_300.ace -a/home/amcguire/alignace/lib/ORF_tpal.txt -z/skink1/amcguire/genomes/tpal.fna -g0.53 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.53 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTP01005 28 AE000520 #2 RTP00862 75 AE000520 #3 RTP00865 103 AE000520 #4 RTP00868 56 AE000520 #5 RTP00869 55 AE000520 Motif number 1 GGATTTTTTGGGATGGCTGACTGCT 1 5 0 GGATGCTGAC 0.867623 -24 ATGACGCACGAGAAAGCCGCTGCAACAGCTC 2 13 1 AGAAGCCGCT 0.926919 -63 TAGGCCGGTGGCAATTCCGACCAGATCGCTT 3 32 0 GCAATCCGAC 0.995421 -72 GGTGGATTCCAGAACTCCGAGCTTATTGTC 3 84 1 AGAATCCGAG 0.955039 -20 TACCGAGTGCGCAAGCGCGCGCGC 4 4 0 GCAACGCGCG 0.976656 -53 TGTGATATGTGCAAATCCGCCTTACGTACCG 4 30 0 GCAATCCGCC 0.997663 -27 CCGCGTGCGTGGATTCTCGCCCACCAGCA 5 9 0 GGATCTCGCC 0.953826 -47 GAAGTTGCTTGCGAAGCCGCGTGCGTGGATT 5 25 0 GCGAGCCGCG 0.986679 -31 GGCTTCGCAAGCAACTTCGACAGAATAA 5 38 1 GCAATTCGAC 0.980285 -18 **** ****** Masking position 9 Map Score: 10.6519 Number of sites scoring better than the average of aligned sites = 743 Number in coding regions = 694 Number in noncoding regions = 49 Number of orfs with sites within 600 bp upstream = 42 Fraction of orfs with sites within 600 bp upstream = 0.0067459 Motif number 2 GCAGCGGCTTTCTCGTGCGTCATTG 2 6 0 TCTCGTGCGT 0.974739 -70 CTTTTCCCTATCGCTTTCACGCTGAGCTGT 2 37 0 TCGCTTTCAC 0.959826 -39 TCCGACCAGATCGCTTTGATTTCGGTAACG 3 18 0 TCGCTTTGAT 0.923086 -86 GCGCGCGCGCTTGCGCACTCGGTACG 4 7 1 GCGCTTGCGC 0.707109 -50 TGCTGGTGGGCGAGAATCCAC 5 2 1 GCTGGTGGGC 0.916121 -54 GCGAAGCCGCGTGCGTGGATTCTCGCCCAC 5 16 0 GTGCGTGGAT 0.945764 -40 TCTGTCGAAGTTGCTTGCGAAGCCGCGTGC 5 32 0 TTGCTTGCGA 0.871442 -24 ********** Masking position 6 Map Score: 3.35406 Number of sites scoring better than the average of aligned sites = 3174 Number in coding regions = 2983 Number in noncoding regions = 191 Number of orfs with sites within 600 bp upstream = 123 Fraction of orfs with sites within 600 bp upstream = 0.0197559 Motif number 3 CTGTTGCAGCGGCTTTCTCGTGCGTCATTG 2 11 0 GGCTTTCTCG 0.962103 -65 TCAGCGTGAAAGCGATAGGGAAAAGGTGGA 2 42 1 AGCGATAGGG 0.952924 -34 CCGAAATCAAAGCGATCTGGTCGGAATTGC 3 23 1 AGCGATCTGG 0.992109 -81 CAATAAGCTCGGAGTTCTGGAATCCACCGG 3 82 0 GGAGTTCTGG 0.964178 -22 CGAGTGCGCAAGCGCGCGCGC 4 2 0 AGCGCGCGCG 0.815219 -55 CGCGCGCGCTTGCGCACTCGGTACGTAAGG 4 12 1 TGCGCACTCG 0.94329 -45 ********** Masking position 2 Map Score: 3.216 Number of sites scoring better than the average of aligned sites = 898 Number in coding regions = 839 Number in noncoding regions = 59 Number of orfs with sites within 600 bp upstream = 46 Fraction of orfs with sites within 600 bp upstream = 0.00738837 Motif number 4 GCACGAGAAAGCCGCTGCAACAGCTCAGCG 2 18 1 GCCGCTGCAA 0.90023 -58 GCGATAGGGAAAAGGTGGATCAAGATAAAC 2 53 1 AAAGGTGGAT 0.968292 -23 GAGCCGTTAGGCCGGTGGCAATTCCGACCA 3 40 0 GCCGGTGGCA 0.993017 -64 GGATAATCTTACCGGTGGATTCCAGAACTC 3 71 1 ACCGGTGGAT 0.992915 -33 ACTCGGTACGTAAGGCGGATTTGCACATAT 4 27 1 TAAGGCGGAT 0.934842 -30 GAGAATCCACGCACGCGGCTTCGCAAGCAA 5 22 1 GCACGCGGCT 0.969558 -34 ********** Masking position 7 Map Score: 2.2394 Number of sites scoring better than the average of aligned sites = 608 Number in coding regions = 566 Number in noncoding regions = 42 Number of orfs with sites within 600 bp upstream = 25 Fraction of orfs with sites within 600 bp upstream = 0.00401542 Motif number 5 ********** No masking Map Score: 8.97716e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 8.97716e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 8.97716e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0