AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i296_mixed11_tpal_reg_300.orf -o296_tpal_300.ace -a/home/amcguire/alignace/lib/ORF_tpal.txt -z/skink1/amcguire/genomes/tpal.fna -g0.53 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.53 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTP00382 170 AE000520 #2 RTP00949 206 AE000520 Motif number 1 TAATGTGCTCGACGTGGCTGCGCTCGCGCTCC 1 34 1 GACGTGCGCG 0.997504 -137 CTGCGCTCGCGCTCCACCACCGTGATCTTAAA 1 51 1 GCTCCACCCG 0.985081 -120 CGTTTTCTCCGCCGTGTCCCGGTGTTCTTCTT 1 89 1 GCCGTGCCGG 0.992101 -82 CAGGTAATTTGACGTGTATCCGTTTTCAAAAT 1 125 1 GACGTGACCG 0.972992 -46 TCAAAATACGCATCCGCCAGCGCCTGAAAGC 1 150 1 CATCCGCGCG 0.989925 -21 AGTGAATCAAGACGTGTCGGCGTCGACGCCCA 2 69 1 GACGTGCGCG 0.997499 -138 GCAAACTCTAGCCCCAGCTCCGGCCGGAACAG 2 123 1 GCCCCACCCG 0.99235 -84 GATTAAAAAGCCTGCGGCAGGGAGTTTGCTGT 2 151 0 CCTGCGCGGG 0.979476 -56 CTCAGTATGATCCGCTTGCGCCAAATAATT 2 187 0 GATCCGTGCG 0.972992 -20 ****** * *** Masking position 12 Map Score: 14.7309 Number of sites scoring better than the average of aligned sites = 860 Number in coding regions = 799 Number in noncoding regions = 61 Number of orfs with sites within 600 bp upstream = 43 Fraction of orfs with sites within 600 bp upstream = 0.00690652 Motif number 2 TAATGTGCTCGACGTGGCTGCGCTCGCGCT 1 34 1 GACGTGGCTG 0.987473 -137 TAAGATCACGGTGGTGGAGCGCGAGCGCAG 1 51 0 GTGGTGGAGC 0.983753 -120 CGTTTTCTCCGCCGTGTCCCGGTGTTCTTC 1 89 1 GCCGTGTCCC 0.979702 -82 CAGGTAATTTGACGTGTATCCGTTTTCAAA 1 125 1 GACGTGTATC 0.926 -46 GCTTTCAGGCGCTGGCGGATGCGTATTT 1 153 0 GCGCTGGCGG 0.98728 -18 CAATGCGGGTGTCGTGGAGTTTTGCGTATT 2 22 0 GTCGTGGAGT 0.934958 -185 AGTGAATCAAGACGTGTCGGCGTCGACGCC 2 69 1 GACGTGTCGG 0.989555 -138 TTTTTTCGTTGCGGTGGGCGTCGACGCCGA 2 85 0 GCGGTGGGCG 0.984164 -122 GTTCCGGCCGGAGCTGGGGCTAGAGTTTGC 2 123 0 GAGCTGGGGC 0.955102 -84 ********** Masking position 5 Map Score: 13.0155 Number of sites scoring better than the average of aligned sites = 732 Number in coding regions = 657 Number in noncoding regions = 75 Number of orfs with sites within 600 bp upstream = 55 Fraction of orfs with sites within 600 bp upstream = 0.00883392 Motif number 3 CATTAAGGGAACGAAGAATACA 1 2 0 ACGAGAATAC 0.98142 -169 CCGGGACACGGCGGAGAAAACGCTTTCGTTT 1 80 0 GCGAGAAAAC 0.995555 -91 TACCTGAACAAAGAAGAACACCGGGACACGG 1 100 0 AAGAGAACAC 0.937506 -71 GAAAAAAAGGGCGTTGCAAACTCTAGCCCCA 2 108 1 GCGTGCAAAC 0.9886 -99 GCTCCGGCCGGAACAGCAAACTCCCTGCCGC 2 139 1 GAAAGCAAAC 0.948484 -68 TTTGGCGCAAGCGGATCATACTGAG 2 192 1 GCGATCATAC 0.974376 -15 *** ******* Masking position 8 Map Score: 4.36624 Number of sites scoring better than the average of aligned sites = 397 Number in coding regions = 366 Number in noncoding regions = 31 Number of orfs with sites within 600 bp upstream = 26 Fraction of orfs with sites within 600 bp upstream = 0.00417604 Motif number 4 TTATCATTAAGGGAACGAAGAATACA 1 6 0 GGGAACAAGA 0.992039 -165 CTCCACCACCGTGATCTTAAACGAAAGCGTT 1 62 1 GTGATCTAAA 0.823247 -109 GTCAAATTACCTGAACAAAGAAGAACACCGG 1 107 0 CTGAACAAGA 0.978694 -64 CCACGACACCCGCATTGAAGTATCAGAGACA 2 35 1 CGCATTAAGT 0.755525 -172 GAGACAAACAGTGAATCAAGACGTGTCGGCG 2 60 1 GTGAATAAGA 0.966901 -147 CGACGCCCACCGCAACGAAAAAAAGGGCGTT 2 92 1 CGCAACAAAA 0.95094 -115 AAATAATTTGGGGATTAAAAAGCCTGCGGCA 2 164 0 GGGATTAAAA 0.957329 -43 ****** **** Masking position 4 Map Score: 2.17003 Number of sites scoring better than the average of aligned sites = 226 Number in coding regions = 209 Number in noncoding regions = 17 Number of orfs with sites within 600 bp upstream = 16 Fraction of orfs with sites within 600 bp upstream = 0.00256987 Motif number 5 TCACGGTGGTGGAGCGCGAGCGCAGCCACG 1 46 0 GGAGCGCGAG 0.994216 -125 TTTGCGTATTGAGGCTCAAGG 2 2 0 GAGGCTCAAG 0.99095 -205 GGCCGGAGCTGGGGCTAGAGTTTGCAACGC 2 118 0 GGGGCTAGAG 0.991484 -89 CCCAAATTATTTGGCGCAAGCGGATCATAC 2 183 1 TTGGCGCAAG 0.973558 -24 ********** Masking position 9 Map Score: 1.59942 Number of sites scoring better than the average of aligned sites = 173 Number in coding regions = 153 Number in noncoding regions = 20 Number of orfs with sites within 600 bp upstream = 18 Fraction of orfs with sites within 600 bp upstream = 0.0028911 Motif number 6 ********** No masking Map Score: 8.26662e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 8.26662e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 8.26662e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0